ID: 942947038

View in Genome Browser
Species Human (GRCh38)
Location 2:181683218-181683240
Sequence CCAGTGCCCGCGAGGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942947033_942947038 5 Left 942947033 2:181683190-181683212 CCCGGGGCGCCGGCATCGCGACG 0: 1
1: 0
2: 14
3: 26
4: 42
Right 942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 181
942947027_942947038 29 Left 942947027 2:181683166-181683188 CCTCCTCTGCGCGGAAAATTTCG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 181
942947026_942947038 30 Left 942947026 2:181683165-181683187 CCCTCCTCTGCGCGGAAAATTTC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 181
942947034_942947038 4 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 181
942947028_942947038 26 Left 942947028 2:181683169-181683191 CCTCTGCGCGGAAAATTTCGACC 0: 1
1: 0
2: 0
3: 0
4: 8
Right 942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 181
942947035_942947038 -4 Left 942947035 2:181683199-181683221 CCGGCATCGCGACGCTCAGCCAG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942947038 Original CRISPR CCAGTGCCCGCGAGGCTCCC AGG Intergenic
900113884 1:1020527-1020549 CCGGCGCCCGCGAGTTTCCCGGG - Intronic
900145962 1:1158754-1158776 CCTGTGCCAGCGAGCGTCCCAGG + Intergenic
900990191 1:6095149-6095171 CCAGGGCCTGCCTGGCTCCCAGG + Intronic
901069253 1:6509109-6509131 CCAGAGGCCGTGAGGCTTCCAGG - Intronic
901510587 1:9716394-9716416 CCTCTGCCCTCGAGGCCCCCCGG - Intronic
902668126 1:17953532-17953554 CCAGTGCCCGAGGGGCCCCAAGG + Intergenic
903349722 1:22710640-22710662 CCAGCGCCCGCGCTGCCCCCGGG + Intergenic
907258874 1:53201062-53201084 CCAGGACCAGCGAGCCTCCCAGG - Intronic
908945284 1:69488152-69488174 CAAGTTCCCGCTAGGCTTCCAGG + Intergenic
913274178 1:117121726-117121748 CCAGAGCCCGCGGGCGTCCCGGG - Exonic
914490018 1:148146183-148146205 CCTGTGGTTGCGAGGCTCCCTGG + Intronic
914827680 1:151147008-151147030 CCCAGCCCCGCGAGGCTCCCAGG - Intergenic
915429874 1:155858115-155858137 CCAGTGTCCAGGAGGCTGCCTGG + Intronic
915904227 1:159866179-159866201 TCAGTGGCCGCCAGACTCCCTGG + Intronic
915914225 1:159931514-159931536 CCAGTGCCCGTGGGCCTCCTTGG + Exonic
919403201 1:197146248-197146270 ACAGCGTCCGTGAGGCTCCCAGG + Exonic
919732573 1:200922611-200922633 ACAGTGCCAGCTCGGCTCCCTGG - Intergenic
919855663 1:201704408-201704430 CCAGCCCCCGCCAGGCTCTCTGG - Intronic
921390520 1:214609031-214609053 CCTGTGGTTGCGAGGCTCCCTGG - Intronic
1065324749 10:24540806-24540828 CCACTGCCCTCCAGCCTCCCGGG - Intronic
1068863375 10:61869054-61869076 ACAGTCACCGCGAGGGTCCCCGG + Intergenic
1069712105 10:70496378-70496400 CCAGTGCCCCAGAGGTTCCCTGG + Intronic
1075693646 10:124418436-124418458 CCAGAGACCCCGAGGCGCCCCGG - Intronic
1075766769 10:124899413-124899435 CCAGTGGCCACGGGGCTGCCTGG - Intergenic
1076024070 10:127098077-127098099 CCAGTGCCTGGGAGGCACCGTGG + Intronic
1076156805 10:128210979-128211001 CCGGTGCCCGCGCGGCCTCCAGG + Intergenic
1076864189 10:133159363-133159385 TCAGTGCCCACCTGGCTCCCGGG + Intergenic
1076871428 10:133196844-133196866 CCACTGTCCCCCAGGCTCCCTGG - Intronic
1077093806 11:791001-791023 CCAATGCCCGCCCTGCTCCCTGG + Exonic
1077122696 11:917598-917620 CCAGCACCCGAGGGGCTCCCTGG - Intergenic
1077147081 11:1051139-1051161 CCGGTGCCCGGGTGGCTCTCAGG - Intergenic
1079031719 11:16991139-16991161 CCTCTGCCCCCGAGACTCCCAGG + Intronic
1083763583 11:64831805-64831827 ACAGTGCACGCTAGGCCCCCGGG - Intronic
1084547412 11:69821323-69821345 CCAGAGCCCGGGAGTTTCCCTGG - Intergenic
1089139734 11:116275989-116276011 CCACGTCCCGCGGGGCTCCCTGG - Intergenic
1089180596 11:116580563-116580585 GCAGGGCCCGCGAGGCGCCCGGG + Intergenic
1089940823 11:122414907-122414929 CCAGTGCCCACATGGCACCCAGG - Intergenic
1096255117 12:50057937-50057959 CCTTTGGCCGCGAGGCTCCTCGG + Intronic
1101873626 12:108584210-108584232 CCAGGGCCCGGGAGGTTTCCCGG - Intergenic
1101940879 12:109098183-109098205 CCAGTCACCGCGACGCTCCTCGG + Intronic
1104624354 12:130339201-130339223 CCAGCACCCGCGAGGACCCCCGG - Intronic
1114137872 14:19873449-19873471 CCAGTACCAGCGGAGCTCCCAGG - Intergenic
1117910852 14:60637431-60637453 CCAGTGCCGGCGAGGCCCCCTGG + Intergenic
1121951225 14:98172429-98172451 CCTGTGGCCGGGAGACTCCCAGG + Intergenic
1123028924 14:105441405-105441427 CCAGCACCGGGGAGGCTCCCAGG + Intronic
1125305400 15:38306688-38306710 CCAGTTCCCACAAGGCTCCGGGG - Intronic
1127588390 15:60398512-60398534 CCAGTTCCCGGGGGGCGCCCGGG + Intronic
1128020708 15:64387886-64387908 CCAGTGCACCAGCGGCTCCCCGG - Exonic
1128482822 15:68054532-68054554 TCAGCGCCCCCGAGGCACCCGGG - Intronic
1131061499 15:89407444-89407466 CGCGTGCCCGCGCGGTTCCCAGG + Intergenic
1131253327 15:90845215-90845237 CCAGGGCCTGCCAGGCCCCCTGG + Intergenic
1131748494 15:95477944-95477966 CCAGTTCCTGAGAGCCTCCCAGG + Intergenic
1132728470 16:1349005-1349027 CCAGTCCCCACGGGGCTCCCAGG + Exonic
1132851308 16:2026290-2026312 CCAGTGGCTGGGAGACTCCCTGG - Intronic
1132851338 16:2026397-2026419 CCAGTGGCTGGGAGACTCCCTGG - Intronic
1136382451 16:29901775-29901797 TCAGTGCCCGATAGGCCCCCGGG - Exonic
1136478450 16:30526953-30526975 CCGGAGCCCGCGGGGCTACCGGG + Intronic
1136519697 16:30787387-30787409 CCGATGCCCGCGAGGGTCCCTGG + Intergenic
1137675944 16:50303983-50304005 CCACTGCCCTTGAGGCTCCTTGG - Intronic
1137849541 16:51725585-51725607 CCAGTTCCCGTGATGCTTCCTGG - Intergenic
1138095587 16:54208861-54208883 CCAGTGCGTGCGAGCCTCTCTGG - Intergenic
1138970503 16:62137074-62137096 CCTGTGTCAGCCAGGCTCCCTGG + Intergenic
1139705395 16:68737598-68737620 CCGGAGCGCGCGAGGCTTCCAGG - Intronic
1140124358 16:72107559-72107581 CCAGCACCCATGAGGCTCCCGGG - Intronic
1140470021 16:75208671-75208693 CCAGTGCCCACCAGGCCCACGGG + Intergenic
1141721177 16:85756140-85756162 CCAGTGCCTGCCAGGGGCCCGGG - Intergenic
1145190624 17:20840834-20840856 CCTGTGGTTGCGAGGCTCCCTGG + Intronic
1145261052 17:21355081-21355103 CAAATGCCCGCGAGGGGCCCTGG - Intergenic
1147648864 17:42050669-42050691 CCAGCGCCGGCCAGGGTCCCGGG + Intronic
1150217024 17:63476737-63476759 CCGGAGGCCGCTAGGCTCCCAGG + Intergenic
1151555044 17:74842573-74842595 CCTGTGCCCCAGAGGCCCCCAGG + Exonic
1152178073 17:78800801-78800823 CCTGGGCCCTCGGGGCTCCCTGG - Intronic
1152392900 17:80013339-80013361 CCAGGGCAGGCGAGGCTCCAGGG - Intronic
1152790885 17:82278928-82278950 CCAGTGTCCTCCTGGCTCCCTGG - Intergenic
1153924496 18:9823921-9823943 CCGGTGCCCACTAGGTTCCCAGG - Intronic
1157701565 18:49764236-49764258 CCAGTGCCCACGGGGCACCCAGG - Intergenic
1160226105 18:77012276-77012298 CCAGTGCCCACAGGGCCCCCCGG - Intronic
1160438212 18:78867371-78867393 CCAGCGCCCGTGAGGAGCCCAGG + Intergenic
1160736001 19:662729-662751 CGAGAGGCCGCGAGGATCCCAGG - Intronic
1160835507 19:1122843-1122865 CCTGTGTCCGCGAGGCCCCTGGG - Intronic
1160969843 19:1762669-1762691 CCAGTGACCCTGAGGCTCCAAGG - Intronic
1160995887 19:1881757-1881779 CCTGTGGTTGCGAGGCTCCCTGG - Exonic
1161039036 19:2100306-2100328 CGAGTGCCTCCCAGGCTCCCTGG + Intergenic
1161401455 19:4067534-4067556 CCCGGGTCCGCGGGGCTCCCGGG + Intergenic
1161643336 19:5437208-5437230 CCTGTCCCCACGGGGCTCCCAGG + Intergenic
1161735937 19:5992053-5992075 CCAGTGCCCCGTATGCTCCCAGG - Intergenic
1162527471 19:11214723-11214745 CCAGTGCCCCCTGGGCTGCCAGG - Intronic
1163103254 19:15109810-15109832 CCTGAGCCTGCGAGGCCCCCGGG + Exonic
1163175906 19:15563998-15564020 CCAATGTCCCCGAAGCTCCCCGG + Intergenic
1163445192 19:17341741-17341763 CCAGATCCCCCGAGGCTCCTGGG - Exonic
1165256328 19:34579012-34579034 CCAGTGCCAGCCAGAGTCCCAGG - Intergenic
1165259051 19:34597501-34597523 CCAGTGCCAGCCAGAGTCCCAGG - Intronic
1167031753 19:46966856-46966878 CCAGTGCCCATGAGGCTGCAGGG + Intronic
1167661489 19:50798360-50798382 CCAGGGCCCGCCAGGCCACCAGG - Exonic
1168110834 19:54190574-54190596 CCACAGGCCGCGAGGCTGCCGGG + Intronic
925063325 2:910223-910245 CCAGTGCAGGCGAGGAGCCCGGG - Intergenic
927439506 2:23102778-23102800 CCATTGCCCTGGAAGCTCCCAGG - Intergenic
927997437 2:27495505-27495527 CCAGTGCCCGAGGGGCTAACAGG + Intergenic
929539609 2:42810043-42810065 CGACTGCCCGCGGGGCCCCCCGG - Intergenic
935746544 2:106194243-106194265 CCTGGACCCGCGCGGCTCCCGGG - Exonic
938119489 2:128623609-128623631 CCACTGCCCACCAGGCTTCCCGG + Intergenic
941580758 2:167293350-167293372 GCAGCGCCCGCGACGCCCCCGGG + Intergenic
942453126 2:176121086-176121108 CCAGTGTCCCAGAGACTCCCTGG - Intergenic
942947038 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG + Intergenic
943333772 2:186590008-186590030 CCAGTGCCGCCGCGGCTCTCAGG + Intergenic
944553240 2:200864501-200864523 CAGGCGCCCGCGAGGCTCACAGG + Exonic
948641751 2:239379561-239379583 CCAGTGCCCGCCCTGCTCTCAGG + Intronic
948748596 2:240113547-240113569 CCAGTGTCCGAGGAGCTCCCGGG - Intergenic
1173836968 20:46132297-46132319 ACAGTGTCTCCGAGGCTCCCTGG + Intergenic
1175440954 20:58990963-58990985 CCAGGGCCTGCCAGGCTCTCGGG + Exonic
1175604156 20:60298804-60298826 GCAGGGGCCGCCAGGCTCCCAGG - Intergenic
1175873853 20:62220401-62220423 CGCGTGCCCGCCAGGCTGCCTGG + Intergenic
1175942269 20:62542955-62542977 CCAGTGACAGGGAGTCTCCCGGG + Intergenic
1176380556 21:6110595-6110617 CGCGAGCCCGCGAGGCCCCCGGG + Intergenic
1176547990 21:8209563-8209585 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1176550087 21:8217180-8217202 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1176555883 21:8253774-8253796 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1176566921 21:8392598-8392620 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1176569014 21:8400215-8400237 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1176574820 21:8436808-8436830 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1176576928 21:8444450-8444472 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1176611435 21:8988105-8988127 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1179011942 21:37563205-37563227 CCAGTGCCAGCCAGAGTCCCCGG - Intergenic
1179582206 21:42351131-42351153 CCTGTGCAGGCGAGGCTTCCGGG + Intergenic
1179742916 21:43427645-43427667 CGCGAGCCCGCGAGGCCCCCGGG - Intergenic
1179902762 21:44402475-44402497 CCAAGGCCCGCGAGCCTCTCTGG - Intronic
1180941020 22:19659496-19659518 CCAGTGCACCCTAGGCACCCAGG + Intergenic
1180980271 22:19875168-19875190 CCAGTGCCAGGGAGGCTCTTGGG - Intergenic
1180987419 22:19913034-19913056 CCAGTCCCCACGGGTCTCCCAGG - Intronic
1181121659 22:20671156-20671178 CCTGTGGTTGCGAGGCTCCCTGG - Intergenic
1181268159 22:21642944-21642966 CGGGTGCCCGCGCGGGTCCCCGG + Exonic
1181334627 22:22118196-22118218 CCTGTGGTTGCGAGGCTCCCTGG - Intergenic
1183380298 22:37487308-37487330 CCTGGGCCAGCGAGGGTCCCAGG - Intergenic
1183476414 22:38038463-38038485 CCTGTGCCCGGGTGGCTCCTGGG - Intronic
1184086634 22:42269918-42269940 CCGGTGCCCCCGGGGCTGCCAGG + Intronic
1184444972 22:44541720-44541742 CCTGTGCCTGCAAGGCTCCCAGG - Intergenic
1185213598 22:49586027-49586049 CCAGTGCCCGCCAGCACCCCTGG - Intronic
1203252869 22_KI270733v1_random:125863-125885 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1203254977 22_KI270733v1_random:133506-133528 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1203260924 22_KI270733v1_random:170945-170967 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1203263033 22_KI270733v1_random:178585-178607 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
950342236 3:12257730-12257752 CCAGTGTTCTCCAGGCTCCCAGG + Intergenic
951334565 3:21405860-21405882 CCCGGGCCAGGGAGGCTCCCGGG - Intergenic
954333188 3:49901719-49901741 CCAAGGCCCAGGAGGCTCCCTGG + Intronic
955228458 3:57079361-57079383 CCGGCGCCCGCGGGGGTCCCCGG - Intergenic
961143905 3:124578412-124578434 CCACTGCCTGCCATGCTCCCTGG - Intronic
961455567 3:127022339-127022361 CCAGTGCCCCCCAGGCTCACCGG - Exonic
962919339 3:139936261-139936283 CCAGAGCTCCCGACGCTCCCAGG - Intronic
966226431 3:177603029-177603051 CCAGTGCCAACAAGGCTCCCTGG - Intergenic
967886249 3:194335738-194335760 CCAGTACCCGCGCTGCGCCCAGG + Intergenic
973608498 4:52611099-52611121 CCATTGCCTGTCAGGCTCCCTGG - Intronic
973758989 4:54100249-54100271 CCCGTGTCTGCGCGGCTCCCAGG + Exonic
974047460 4:56908946-56908968 CCAGGGCCGGGGAGGCTCCGCGG - Intronic
976398709 4:84583698-84583720 CCAGTGGCGGTGAGGTTCCCAGG + Intronic
983158063 4:164376655-164376677 CCACTGACTGCGAGGCTCCATGG + Intronic
985553250 5:543744-543766 CCAGAGCCCCCCAGGCTCCAAGG - Intergenic
999600187 5:153253948-153253970 CCAGTGCCAGGCTGGCTCCCAGG - Intergenic
1003545077 6:7052073-7052095 CCTGCGCCCGCGAGGAGCCCAGG + Intergenic
1013175304 6:107671296-107671318 TCAGTGCCCAAGAGGCTCCATGG + Intergenic
1014725003 6:124962743-124962765 CCAGAGCCCGCGAGGAGCCTGGG + Exonic
1016386826 6:143537280-143537302 CCAGTGCCCGCGGGCGCCCCGGG - Intronic
1017725734 6:157274911-157274933 GCAGTCCCCGCGGCGCTCCCGGG - Intergenic
1018950276 6:168374411-168374433 ACAGAGCCCGCGAGGCACCTGGG + Intergenic
1019529704 7:1497245-1497267 GCAGGGCCCGCGAGGCCCGCAGG + Exonic
1020274437 7:6615846-6615868 CCGCTGCCCGCGATGGTCCCGGG + Exonic
1022714924 7:32891209-32891231 TCGGCGCCCGCGGGGCTCCCGGG - Intronic
1023635178 7:42202700-42202722 CCAGTGTCCTCCAGGCCCCCAGG + Intronic
1023866195 7:44239464-44239486 CCAGAGGCCGCCAGGCCCCCGGG - Intronic
1023998944 7:45178477-45178499 CCAGGGCCGGGGAGGCTTCCTGG - Intronic
1026539981 7:71271401-71271423 CCAGTGGCCACGTGGCTCCCTGG + Intronic
1027423183 7:78037089-78037111 CCAGTGCCCCCAAGGCATCCAGG + Intronic
1028844964 7:95470027-95470049 ACAGAGCCCACGAGGCTCCCAGG + Intergenic
1029207761 7:98879276-98879298 CCAGGGCCCCCCAGGCTCCGCGG + Intronic
1034160922 7:148993758-148993780 GCTGTGCCAGCGAGGCTCCTGGG + Intergenic
1038029285 8:23622962-23622984 CCTATCCCCGCGCGGCTCCCTGG - Intergenic
1049553440 8:143271058-143271080 CCAGTGCCCAGGAGGCTTCCAGG - Intronic
1056020510 9:82433571-82433593 CCAGATCCCGCCAGGCTCCCCGG + Intergenic
1056576697 9:87860042-87860064 CCAGATCCCGCCAGGCTCCCCGG + Intergenic
1056765067 9:89440131-89440153 CCACAGCCTGCGTGGCTCCCAGG - Intronic
1060893061 9:127200693-127200715 CCACTGCCGGGGTGGCTCCCAGG - Intronic
1061212706 9:129203028-129203050 CCGGCGCCCGCGCGGCTCACGGG + Intergenic
1061295028 9:129672287-129672309 GCTGTGCCCACGAGGCTTCCCGG - Intronic
1061300799 9:129703913-129703935 GCAGTGCCTGCGAGGCTGACGGG - Intronic
1062699472 9:137891428-137891450 CCAGTGCCCTGGGGGGTCCCAGG + Intronic
1062718035 9:138021002-138021024 CCAGTGCCCGAGAGGGGCCTGGG - Intronic
1203469271 Un_GL000220v1:109010-109032 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1203471379 Un_GL000220v1:116652-116674 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1203477092 Un_GL000220v1:152982-153004 CCCGTCCTCGCGAGGCCCCCCGG + Intergenic
1203479200 Un_GL000220v1:160624-160646 CCGGCGCCCGCCGGGCTCCCCGG - Intergenic
1185465238 X:350700-350722 CCAGGTCCCGCGAGGCTGCCAGG + Intronic
1188141520 X:26557795-26557817 CCCGGGCCAGGGAGGCTCCCAGG - Intergenic
1190691500 X:52916630-52916652 CCAGACCCAGAGAGGCTCCCGGG - Intergenic
1190694483 X:52939162-52939184 CCAGACCCAGAGAGGCTCCCGGG + Intronic
1197709366 X:129654735-129654757 GCAGAGCTCGGGAGGCTCCCCGG + Exonic
1200014376 X:153147430-153147452 CCAGTGCCCGGGAGCATCACTGG + Intergenic
1200025226 X:153252524-153252546 CCAGTGCCCGGGAGCATCACTGG - Intergenic
1200064029 X:153496301-153496323 CCCGTGCCAGAAAGGCTCCCGGG + Intronic