ID: 942947041

View in Genome Browser
Species Human (GRCh38)
Location 2:181683226-181683248
Sequence CGCGAGGCTCCCAGGAGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942947033_942947041 13 Left 942947033 2:181683190-181683212 CCCGGGGCGCCGGCATCGCGACG 0: 1
1: 0
2: 14
3: 26
4: 42
Right 942947041 2:181683226-181683248 CGCGAGGCTCCCAGGAGATGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
942947035_942947041 4 Left 942947035 2:181683199-181683221 CCGGCATCGCGACGCTCAGCCAG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 942947041 2:181683226-181683248 CGCGAGGCTCCCAGGAGATGCGG 0: 1
1: 0
2: 1
3: 13
4: 188
942947034_942947041 12 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947041 2:181683226-181683248 CGCGAGGCTCCCAGGAGATGCGG 0: 1
1: 0
2: 1
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942947041 Original CRISPR CGCGAGGCTCCCAGGAGATG CGG Intergenic
900237053 1:1597927-1597949 CCCAAGGGTCCCAGGGGATGTGG + Intergenic
900941174 1:5799563-5799585 CGAGTGGTTCCCAGGAGCTGGGG + Intergenic
901003690 1:6161405-6161427 AGCGGGGCTTCCAGGAGAGGAGG - Intronic
901455744 1:9361832-9361854 CGCCACCCTCCCTGGAGATGTGG + Intronic
902447439 1:16476149-16476171 GGGGAGGCTCCCAGGCAATGAGG + Intergenic
902467293 1:16626099-16626121 GGGGAGGCTCCCAGGGAATGAGG + Intergenic
902507292 1:16946645-16946667 GGGGAGGCTCCCAGGGAATGAGG - Intronic
912818666 1:112849942-112849964 GGCGACGCTCCCGGGAGACGCGG - Intergenic
917045816 1:170858927-170858949 AGTGAGGCTCTCAGGAGATCTGG + Intergenic
917474354 1:175355559-175355581 TGGGAGGCTGCCAGGAGATCAGG + Exonic
919798629 1:201337159-201337181 CCCCAGGCTCCGAGGAGCTGTGG + Intergenic
919924979 1:202187531-202187553 AGTGAGACTCACAGGAGATGGGG - Intergenic
920712260 1:208306532-208306554 CCCTGGGCACCCAGGAGATGTGG + Intergenic
1063615961 10:7600720-7600742 GGTGATGGTCCCAGGAGATGGGG + Intronic
1063753579 10:8980179-8980201 AGCGATGCTCCCACTAGATGAGG + Intergenic
1064444130 10:15378751-15378773 CCCCAGGATCCCAGGAGAGGGGG - Intergenic
1067066441 10:43106597-43106619 GGCTAGGCCCCCAGGAAATGAGG + Intronic
1068561014 10:58513704-58513726 CTCGAGGCTGCCAGGGAATGGGG - Intronic
1070954438 10:80454818-80454840 CCCTCGGCTCCCAGGAGATCGGG + Intronic
1071966702 10:90858624-90858646 CCCCTGGCACCCAGGAGATGAGG + Intergenic
1073141986 10:101254216-101254238 CCCTAGGCTCCTAGGGGATGGGG + Intergenic
1074300122 10:112225961-112225983 GGGGAGGCTCCCAGGGGAGGTGG - Intergenic
1076762073 10:132610949-132610971 CAGGAGGATCTCAGGAGATGAGG + Intronic
1077535731 11:3123064-3123086 CCCACGGCTCCCAGGGGATGGGG - Intronic
1083270940 11:61572192-61572214 GGGGAGGCTCTCAGGAGAAGGGG - Intronic
1083281127 11:61627930-61627952 GGCGAGGCTCACGGCAGATGTGG - Intergenic
1083295888 11:61715491-61715513 AGCAAGACTCCCAGCAGATGGGG - Intronic
1083623691 11:64061076-64061098 CGCGAGGCTCTCAGGTGGTTGGG - Intronic
1085644847 11:78216343-78216365 CTCCAGGCCCCCAGGAGAGGTGG + Exonic
1090974620 11:131670923-131670945 CAGGAGGCTCCCAGGGAATGTGG + Intronic
1091176570 11:133563703-133563725 GATGATGCTCCCAGGAGATGGGG + Intergenic
1091718187 12:2794736-2794758 TCCGAGGGTCCCAGGAGAAGGGG + Intergenic
1091851261 12:3698961-3698983 CCTGCTGCTCCCAGGAGATGAGG + Intronic
1092288032 12:7141150-7141172 CCCCTGTCTCCCAGGAGATGGGG + Intronic
1095735004 12:45547065-45547087 GGCGAGGACCCCAGGGGATGGGG - Intergenic
1096241917 12:49964191-49964213 CCCCTGGCTCCCTGGAGATGAGG + Intronic
1100982174 12:100170525-100170547 AGCCAGGCTGCCAGGGGATGGGG + Intergenic
1102278383 12:111599479-111599501 CGCGGGACTCCGAGGAGCTGCGG + Exonic
1103941702 12:124504848-124504870 CCCGAGGCTGCCAGGGGTTGTGG + Intronic
1104845947 12:131846928-131846950 CGGAGGGCTCCCAGGTGATGGGG - Intronic
1104958303 12:132476514-132476536 CCAGGGGCTCCGAGGAGATGTGG - Intergenic
1106416635 13:29551356-29551378 CGAAAGGCCTCCAGGAGATGTGG + Intronic
1106484042 13:30157030-30157052 TGCCGGCCTCCCAGGAGATGAGG + Intergenic
1112816134 13:103275561-103275583 CGCCAGACTCCCAAGAAATGAGG - Intergenic
1113608370 13:111626378-111626400 CATGAGTCACCCAGGAGATGGGG - Intronic
1113693219 13:112326615-112326637 CTCCAGGCCTCCAGGAGATGGGG - Intergenic
1122004761 14:98693007-98693029 GGTGAGGGTCACAGGAGATGAGG - Intergenic
1122978103 14:105179253-105179275 CCCGTGGCTCCGAGGCGATGGGG - Intronic
1123645291 15:22433494-22433516 AGCCAGGCTCCCAGGGGACGGGG + Intergenic
1123751149 15:23359227-23359249 AGCCAGGCTCCCAGGGGACGGGG - Intronic
1124283524 15:28383145-28383167 AGCCAGGCTCCCAGGGGACGGGG - Intronic
1124299174 15:28528468-28528490 AGCCAGGCTCCCAGGGGACGGGG + Intronic
1124320402 15:28707708-28707730 AGCCAGACTCCCAGGGGATGGGG + Intronic
1124482112 15:30087702-30087724 AGCCAGGCTCCCAGGGGATGGGG - Intronic
1124488570 15:30139802-30139824 AGCCAGGCTCCCAGGGGATGGGG - Intronic
1124521476 15:30409501-30409523 AACCAGGCTCCCAGGGGATGGGG + Intronic
1124537185 15:30556718-30556740 AACCAGGCTCCCAGGGGATGGGG - Intronic
1124543656 15:30608774-30608796 AGCCAGGCTCCCAGGGGATGGGG - Intronic
1124754958 15:32398520-32398542 AGCCAGGCTCCCAGGGGATGGGG + Intronic
1124761468 15:32450873-32450895 AACCAGGCTCCCAGGGGATGGGG + Intronic
1124777164 15:32598195-32598217 AACCAGGCTCCCAGGGGATGGGG - Intronic
1126473826 15:49046140-49046162 TGCCAGGCTCCCAGGTGAGGGGG + Intronic
1129029675 15:72609215-72609237 AGCCAGGCTGCCAGGGGATGGGG - Intergenic
1129037611 15:72660247-72660269 AGCCAGGCTGCCAGGGGATGGGG - Intronic
1129170426 15:73804240-73804262 CGAGGGGCTGCCAGGAGAAGGGG - Intergenic
1129189878 15:73931010-73931032 GGCGAGGATCCCAGGAGAGGAGG - Intronic
1129212276 15:74076978-74077000 AGCCAGGCTGCCAGGGGATGGGG + Intronic
1129398121 15:75264101-75264123 AGCCAGGCTGCCAGGGGATGGGG - Intronic
1129401732 15:75288382-75288404 AGCCAGGCTGCCAGGGGATGGGG - Intronic
1129475325 15:75781089-75781111 AGCCAGGCTGCCAGGGGATGGGG - Intergenic
1129729405 15:77921296-77921318 AGCCAGGCTGCCAGGGGATGGGG + Intergenic
1129839111 15:78732674-78732696 AGCCAGGCTGCCAGGGGATGGGG - Intergenic
1130519905 15:84654325-84654347 CGCGCGGCTCTCGCGAGATGTGG + Exonic
1131065742 15:89433937-89433959 AGCCAGGCTCCCAGGAGCAGTGG - Intergenic
1132698901 16:1213948-1213970 CGCGAGGGGCCCAGGGGCTGGGG + Intronic
1134207421 16:12249497-12249519 CGTGTGGATCCCAGGAGGTGGGG + Intronic
1136077832 16:27828950-27828972 CGCCAGGCTGCCAAGAGATCAGG + Exonic
1136125298 16:28175185-28175207 GGTGAGGCACCCAGGGGATGGGG - Intronic
1140954447 16:79849231-79849253 CGCCAGGCCTCCAGGAGCTGGGG - Intergenic
1141572582 16:84942894-84942916 CTGGAGGCTGCCAGGAGCTGGGG - Intergenic
1142928656 17:3263121-3263143 CTGGTGGCTCCCAGGAGCTGGGG - Intergenic
1143658741 17:8312216-8312238 CTGGGGGCTCCCAGAAGATGGGG - Exonic
1143952052 17:10640780-10640802 GGCCAAGGTCCCAGGAGATGAGG + Intronic
1144573671 17:16416014-16416036 GGTGAGGGTCCCAGGAGGTGGGG + Intronic
1144585874 17:16487392-16487414 CTGGAGACTCCCTGGAGATGTGG - Intronic
1145981063 17:29011841-29011863 CGGGAGGCTACAGGGAGATGCGG + Intronic
1147429876 17:40364519-40364541 GGGGAGGATCTCAGGAGATGTGG - Exonic
1148538064 17:48457206-48457228 GGGGAGGCGCCCAGGTGATGGGG + Intergenic
1148859889 17:50599341-50599363 AGTGAGGCTCCCAGGAGACCGGG + Intronic
1149884540 17:60327606-60327628 CACCAGGCTGCAAGGAGATGCGG + Intronic
1152070503 17:78131729-78131751 CGCGTGGCACCCACCAGATGAGG - Exonic
1152881032 17:82815411-82815433 CGTGGTGCTCCCTGGAGATGAGG + Intronic
1152937769 17:83150460-83150482 CCCCAGGCTCCCAGGAGCAGGGG + Intergenic
1155213016 18:23619239-23619261 CGGGAGGCCCCCAGGACAGGCGG + Intronic
1155213025 18:23619259-23619281 CGGGAGGCCCCCAGGACAGGCGG + Intronic
1155257749 18:24014085-24014107 CGCGGGGCTCCGGGGAGCTGCGG + Intronic
1157561238 18:48647980-48648002 GGAAAGGCTTCCAGGAGATGGGG - Intronic
1159020664 18:63140622-63140644 TTAGAGGTTCCCAGGAGATGGGG + Intronic
1160672581 19:373352-373374 ACAGAGGCTCCGAGGAGATGGGG + Intronic
1160915732 19:1495686-1495708 CCGGAGGATACCAGGAGATGGGG + Intronic
1160972658 19:1776320-1776342 GCCCAGGCTCCCAGGAGAAGGGG + Exonic
1160998733 19:1897847-1897869 TGCAGGGCTCCCAGGAGAGGCGG + Intergenic
1161086666 19:2338656-2338678 AGTGAGGGTCCCAGGAGAGGAGG + Intronic
1161281599 19:3448685-3448707 CGGGTGACTCCCAGGTGATGGGG + Intronic
1161315623 19:3615985-3616007 CGCGAGGCTCCCAGGAAGCCAGG + Intronic
1162026004 19:7894557-7894579 CAGGAGGCTCCCAGGAGTGGGGG + Intronic
1163393387 19:17044289-17044311 AGTGAGACTCCCAGGAGCTGGGG + Intergenic
1163393603 19:17045829-17045851 AGCGAGACTCCCAGGGGCTGGGG - Intergenic
1164054159 19:21607467-21607489 AGAGACGCTCCCAGGAGAAGGGG + Intergenic
1166267020 19:41690682-41690704 CCCGAGGGTCCCTGGAGATGGGG - Intronic
1166796668 19:45430317-45430339 AGCGAGGCCCACAGGAGATAAGG - Intronic
1167272605 19:48514310-48514332 CCCGAGACTCCCAGAAGGTGAGG - Intergenic
1167639135 19:50670742-50670764 CGTGAGGCTCCCTGGGGTTGAGG - Intronic
924983950 2:251393-251415 CACCAGACTCCCAGGAGAAGTGG + Intronic
925969412 2:9096286-9096308 GGCGAGTCTCCCAGGAAATGGGG - Intergenic
926372924 2:12198512-12198534 TGAGAGCCTCCCAGGAGCTGGGG - Intergenic
926914385 2:17878621-17878643 AGCGAGGCTCCCGGGAGCTGCGG - Intronic
929122767 2:38496991-38497013 AGCGAGGCCCCCAGCATATGGGG - Intergenic
930189307 2:48441168-48441190 CCTGCAGCTCCCAGGAGATGGGG + Intronic
930999060 2:57759663-57759685 CGCCAGGCACCTAGGAGCTGTGG + Intergenic
933164855 2:79064799-79064821 CCAGAGGCTCCCAGTAGATTTGG - Intergenic
933658257 2:84906293-84906315 GGCGAGGCACCCACGAGGTGTGG - Intronic
934762853 2:96865911-96865933 CGGGGGCCTCCCAGGAGATCTGG + Exonic
934771451 2:96910237-96910259 CGGAGGGCTTCCAGGAGATGGGG - Intronic
937018661 2:118630817-118630839 TGAGAGGCTCCCAGGTGTTGGGG - Intergenic
938367317 2:130745007-130745029 CTCCAGGCTGCCAGGAGCTGAGG + Intergenic
942947041 2:181683226-181683248 CGCGAGGCTCCCAGGAGATGCGG + Intergenic
948462988 2:238139176-238139198 CCCGAGGCCCCCAGGGGAAGTGG + Intronic
1169277363 20:4243006-4243028 CTGGAGGCTCCCGGGAGAGGAGG + Intronic
1169351023 20:4867988-4868010 CTCCCAGCTCCCAGGAGATGTGG - Intronic
1171555796 20:26081688-26081710 CGCGATGCTGGCTGGAGATGCGG - Intergenic
1173115228 20:40235601-40235623 GAGGAGGATCCCAGGAGATGTGG - Intergenic
1173210477 20:41028420-41028442 CTCGCCGCTCCAAGGAGATGCGG + Intergenic
1173228192 20:41174261-41174283 CGAGATGCTCCTGGGAGATGCGG - Exonic
1174707043 20:52667651-52667673 GGGGAGGCACCAAGGAGATGAGG - Intergenic
1174895855 20:54449363-54449385 CGTGAAGCTCACAGTAGATGGGG - Intergenic
1175248134 20:57593494-57593516 CACGAGGGGCCCATGAGATGTGG + Intergenic
1175408457 20:58750699-58750721 TGAGAGGCTTCCTGGAGATGAGG + Intergenic
1176110200 20:63407546-63407568 CGGGCTGCTCCCAGGAAATGGGG + Intronic
1176274345 20:64255432-64255454 CGCAGGGCACCCTGGAGATGCGG + Intergenic
1176949559 21:15029269-15029291 AGGGAGGGTCACAGGAGATGAGG - Intronic
1176952727 21:15065190-15065212 CGGGCGGCTCACAGGAGCTGCGG + Intergenic
1181674777 22:24444575-24444597 GGCCAGGCTGCCAGGAGCTGTGG + Intergenic
1182420002 22:30244438-30244460 CGTGAGGCACCAGGGAGATGCGG - Intronic
1182877444 22:33704517-33704539 CGAGAGGCTCCCGGCAGATGAGG - Intronic
1184480723 22:44745348-44745370 AGAGAGGCTCCCATGATATGGGG + Intronic
1184683580 22:46085881-46085903 GGTCAGGCTCCCAGGAAATGGGG - Intronic
1184935472 22:47717298-47717320 CGGGAGGCTGGCAGGAGATTCGG - Intergenic
950078771 3:10206344-10206366 AGCCAGGCTCCCAGCAGCTGGGG + Intronic
951444654 3:22764678-22764700 AGCCAGTCTCCCAGAAGATGGGG + Intergenic
951881504 3:27484574-27484596 CGCTAGGCCACCGGGAGATGGGG + Intergenic
966516024 3:180821538-180821560 TGCCAGGCTTCCAGCAGATGTGG + Intronic
966558799 3:181295132-181295154 TGTGAGGCTCCCATGAGATAAGG - Intergenic
967759143 3:193204222-193204244 GGAGAGGGTCCCAGGAAATGTGG + Intergenic
968230626 3:197002993-197003015 CGCGAGGCCCCCTGGGGACGCGG - Exonic
968427771 4:534754-534776 CACAAAGCTGCCAGGAGATGGGG - Intronic
968729513 4:2262929-2262951 CGAGAGGCTCCCCGGAGTGGGGG + Intergenic
968959401 4:3735292-3735314 GGCGAGGCTGTCAGGAGACGCGG + Intergenic
975376773 4:73655201-73655223 CAAGAGGCTGCCAGGGGATGAGG - Intergenic
977194136 4:94038388-94038410 CAGGAGGCTCCCAGGAGAATTGG + Intergenic
977954485 4:103011325-103011347 GGCAAGGCTCCCAGGAGACATGG - Intronic
981229025 4:142331395-142331417 CACGAGGATCCCAGTAGATCTGG - Intronic
983751935 4:171284869-171284891 TGCGAGGCTACCAGGAGAACTGG - Intergenic
985616574 5:926607-926629 CGCGAGGGGCCCAGGAGGGGCGG - Intergenic
985692699 5:1322349-1322371 GGCGGGCCTCCCAGGACATGTGG + Intronic
986256270 5:6103522-6103544 CCCCATGCTCCGAGGAGATGTGG + Intergenic
991064747 5:62413014-62413036 AGTGGGGCTACCAGGAGATGAGG + Intronic
996774132 5:127116270-127116292 GGCAAGGATCCTAGGAGATGGGG + Intergenic
1003098947 6:3162821-3162843 CGCGAGGCACCCGGGAGAGCCGG + Intergenic
1005643997 6:27824271-27824293 CGCGAGTCTCCTCGTAGATGAGG - Exonic
1005645200 6:27831359-27831381 CGCGAGTCTCCTCGTAGATGAGG + Exonic
1006225616 6:32534620-32534642 CGCGAGGCACACGGGACATGGGG - Intergenic
1006594976 6:35186178-35186200 CCCCATGCTCCCAGGAGCTGAGG + Intergenic
1006634548 6:35452560-35452582 CGCGGGGCTCCCTGGGGCTGAGG + Exonic
1007692336 6:43710636-43710658 GGTGAGGGTCCCAGGAGATATGG + Intergenic
1019505295 7:1387463-1387485 CGCGAGGGGCGCACGAGATGGGG - Intergenic
1019899298 7:4007413-4007435 CCCGAGGCTTCCTGTAGATGAGG - Intronic
1021931101 7:25582089-25582111 CACGGGGCTCCCAGAAGTTGGGG + Intergenic
1022203088 7:28136926-28136948 CGGGAGGCTCGCAGGAGATGAGG + Intronic
1023586649 7:41738041-41738063 CAAGGGGCTCCCAGGAGAGGTGG + Intergenic
1025724092 7:64042130-64042152 CGTGAGGCTCTCATGAGAGGAGG - Intronic
1025724314 7:64043585-64043607 CGTGAGGCTCTCATGAGAGGAGG + Intronic
1025963944 7:66250260-66250282 CTTGAGGCTCCCAGAAGTTGAGG + Intronic
1028400135 7:90416637-90416659 CTCGAGGTTACCAGGAGAAGTGG + Intronic
1031144373 7:117981478-117981500 CGGGAGGGTCCCAGGAACTGGGG - Intergenic
1033311492 7:140265094-140265116 CGTGTGACTCCCAGGACATGTGG + Intergenic
1034420158 7:150986387-150986409 CGAGGGGCTCCCAGGAAATGGGG - Intergenic
1034682185 7:152937350-152937372 CCCAGGTCTCCCAGGAGATGGGG - Intergenic
1036791125 8:11720999-11721021 CGCCAGGCTCACAGGGAATGGGG - Intronic
1037461879 8:19118768-19118790 CTAGAGGCTTCCAGGGGATGGGG - Intergenic
1038619814 8:29131156-29131178 CTGGAGACTCCCAGGAGTTGGGG + Intronic
1041115438 8:54531404-54531426 AGCAAGGCCCCCAAGAGATGTGG + Intergenic
1048443880 8:134479007-134479029 CCCGGGGCTTCCAGGAGGTGTGG + Intronic
1048851755 8:138652107-138652129 CGGGGGGCTCCCAGGAGCTCTGG - Intronic
1051240925 9:15055002-15055024 CGGGAGGCAGCGAGGAGATGCGG - Intergenic
1051287218 9:15510220-15510242 CGGGAGGCGGCGAGGAGATGCGG + Exonic
1058176165 9:101738284-101738306 CCCGAGGCGCCCTGCAGATGGGG - Exonic
1060839266 9:126781387-126781409 CAAGAGGCTCCCAGGTGATGGGG + Intergenic
1061009017 9:127944417-127944439 CCCCAGGCTCCCAGGTGAGGTGG + Intronic
1061584103 9:131555139-131555161 CGGGAGGCTCCCTGGAGGTGGGG + Intergenic
1190283810 X:48948888-48948910 CCAGAGGATCCCAGGAGCTGAGG + Intronic
1197705082 X:129629096-129629118 CGCCAGGCTCCTAGGAGAAGAGG + Intergenic
1198667145 X:139037108-139037130 AGCGAGGCTTCAGGGAGATGTGG - Intronic