ID: 942947042

View in Genome Browser
Species Human (GRCh38)
Location 2:181683227-181683249
Sequence GCGAGGCTCCCAGGAGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942947035_942947042 5 Left 942947035 2:181683199-181683221 CCGGCATCGCGACGCTCAGCCAG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 942947042 2:181683227-181683249 GCGAGGCTCCCAGGAGATGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
942947034_942947042 13 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947042 2:181683227-181683249 GCGAGGCTCCCAGGAGATGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262
942947033_942947042 14 Left 942947033 2:181683190-181683212 CCCGGGGCGCCGGCATCGCGACG 0: 1
1: 0
2: 14
3: 26
4: 42
Right 942947042 2:181683227-181683249 GCGAGGCTCCCAGGAGATGCGGG 0: 1
1: 0
2: 1
3: 27
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942947042 Original CRISPR GCGAGGCTCCCAGGAGATGC GGG Intergenic
900744297 1:4350886-4350908 GAGATGCTGCCTGGAGATGCAGG - Intergenic
900782148 1:4625244-4625266 CCGAGTCTCCCTGGAGATGAAGG + Intergenic
900832661 1:4976408-4976430 GAGAGTCTCCCAAGAGATGCAGG + Intergenic
900940325 1:5794351-5794373 CCAAGGCTCCCAAAAGATGCAGG + Intergenic
901003689 1:6161404-6161426 GCGGGGCTTCCAGGAGAGGAGGG - Intronic
901520348 1:9779086-9779108 GCGAGCCTCCCTGGAGCAGCAGG + Intronic
901879907 1:12187770-12187792 GGAGGGCTCCCAGGAGAAGCAGG + Intronic
902189226 1:14749759-14749781 GAATGGCTCCCAGGAGAGGCAGG - Intronic
902447440 1:16476150-16476172 GGGAGGCTCCCAGGCAATGAGGG + Intergenic
902467294 1:16626100-16626122 GGGAGGCTCCCAGGGAATGAGGG + Intergenic
902507291 1:16946644-16946666 GGGAGGCTCCCAGGGAATGAGGG - Intronic
903181822 1:21608651-21608673 GAGGAGTTCCCAGGAGATGCTGG - Intronic
904261498 1:29290242-29290264 AGGAGGCTCCCAGGAAATGGTGG - Intronic
904343432 1:29852806-29852828 AGCAGGCTCCCAGGACATGCTGG + Intergenic
905541413 1:38763297-38763319 GCGTGGCTCCCAGCACATACAGG - Intergenic
907194390 1:52674855-52674877 GCAAGGCTCTAAGGAGATTCTGG - Intergenic
907303925 1:53503495-53503517 GCCAGGCTCCCATGTGCTGCGGG + Intergenic
907444487 1:54499248-54499270 CCGAGGCTCCGAGGAGACCCCGG + Intergenic
910843554 1:91584557-91584579 AACAAGCTCCCAGGAGATGCAGG + Intergenic
912818665 1:112849941-112849963 GCGACGCTCCCGGGAGACGCGGG - Intergenic
914946717 1:152073264-152073286 GGAAGGCTCCCAGGAGAAGATGG - Intergenic
915288885 1:154869790-154869812 GCGAGGGTCCCAGGGGCTGCTGG + Exonic
915914142 1:159931185-159931207 GCCAGGCTCCCAGGAGACATTGG + Exonic
916031426 1:160880761-160880783 GGCAGCATCCCAGGAGATGCTGG - Intronic
916443531 1:164850944-164850966 GAGAGTCCCGCAGGAGATGCTGG + Exonic
917084868 1:171295213-171295235 GGGATGCTCCAAGGAAATGCAGG - Intergenic
917474355 1:175355560-175355582 GGGAGGCTGCCAGGAGATCAGGG + Exonic
918310059 1:183279418-183279440 GCGTGGCTCCCAGGCGTTCCAGG + Intronic
923496610 1:234531110-234531132 ACGAGGCTTCCAGGAGATGAAGG + Intergenic
1062857774 10:788018-788040 GGGAGGCTGCCAGGACAGGCAGG + Intergenic
1064354308 10:14604043-14604065 GCGCGGCGCCCGGGAGGTGCCGG - Intronic
1068029376 10:51688263-51688285 AACAGGCTCCCAGGTGATGCTGG + Intronic
1070290165 10:75108769-75108791 GGGAGTCTCCCAGGAGTTCCAGG - Intronic
1070777847 10:79120454-79120476 CAGAGCCTCCCAGGAGCTGCTGG - Intronic
1070912694 10:80132482-80132504 CCCGGGCTCCCAGGAGGTGCGGG + Intronic
1071423961 10:85529539-85529561 GGGAGGCTGCCAGGTGATACAGG + Intergenic
1072468406 10:95689212-95689234 GAGAAGCTCTCAGGTGATGCTGG - Intronic
1072654511 10:97320584-97320606 GAGAGGCTGCGAGGAAATGCAGG - Exonic
1073442303 10:103559368-103559390 CAGTGGCTCCCAGCAGATGCTGG + Intronic
1074300121 10:112225960-112225982 GGGAGGCTCCCAGGGGAGGTGGG - Intergenic
1075343826 10:121667840-121667862 TGGAGGCTCCCAGAAGAGGCAGG - Intergenic
1075578508 10:123598267-123598289 GAGTGGCTCCCAGGAGGAGCGGG - Intergenic
1076245240 10:128942273-128942295 GCCTGGCTCCCAGGGGATGCTGG - Intergenic
1076440885 10:130480760-130480782 GGGAGGCGCCCAGGTGATCCAGG + Intergenic
1076804038 10:132846345-132846367 GCAAGGCTCCCCTGGGATGCTGG + Intronic
1077407736 11:2390196-2390218 GCCAGGCTCCAAGTAGATGGCGG + Intronic
1077592387 11:3502429-3502451 GAGAGGCTTCCAGGGGCTGCAGG - Intergenic
1078617466 11:12879211-12879233 GCCATGGTCCCAGGAGCTGCTGG - Intronic
1080433509 11:32219421-32219443 GCCAGGCTCCCATGAGGTTCGGG - Intergenic
1080927937 11:36777503-36777525 CCGAGGCTTCCAGGACTTGCAGG - Intergenic
1081657485 11:44867126-44867148 TCCAGGTTCCCAGGAGATGCTGG - Intronic
1087528019 11:99342652-99342674 GGCAGGATCCCAGGAGATGGAGG + Intronic
1089307964 11:117538632-117538654 TCGAGACTCCCTGGAGCTGCAGG + Intronic
1090403957 11:126466343-126466365 GCTAGGGGCCCAGGAGGTGCTGG - Intronic
1091718189 12:2794737-2794759 CCGAGGGTCCCAGGAGAAGGGGG + Intergenic
1091818713 12:3458504-3458526 GCACGGCTCACAGGAGATCCTGG - Intronic
1094853367 12:34392222-34392244 GCGTGGCTCCCAGGGGACCCTGG + Intergenic
1094853629 12:34393328-34393350 GCGTGGGGCCCAGGAGATCCGGG + Intergenic
1094854310 12:34396141-34396163 GCGCAGGTCCCAGGGGATGCTGG + Intergenic
1094854400 12:34396516-34396538 GCGAGGGGCCCAGGAGACCCTGG + Intergenic
1096214649 12:49792491-49792513 GAGAGGGTCCGAGGAGCTGCCGG + Exonic
1096229933 12:49891145-49891167 GGGAGGGACCCAGGAGAGGCTGG - Intronic
1096472845 12:51889898-51889920 GCCAGGCTTCCAGGGGATCCAGG + Intronic
1100329770 12:93571975-93571997 GCGGGGCTCCGAGGCGAGGCCGG - Exonic
1100562771 12:95765613-95765635 CCGAGGCTCCAAGGATATGGTGG - Intronic
1100898580 12:99213246-99213268 GCACAGCTCCCAGGAGGTGCTGG + Intronic
1101598049 12:106184483-106184505 TCGAGGTTCCCAGGAGTTGGTGG - Intergenic
1105794189 13:23834166-23834188 GAGAGGCTTCCTGGAGAGGCAGG - Intronic
1113779691 13:112969064-112969086 GCGGGGCTCCCAGGTGACCCCGG + Intronic
1113890470 13:113732679-113732701 GCGAAGCTCCCAGGAGCCACAGG - Intronic
1114007879 14:18333330-18333352 GCGAGGCTCCCTGGAGCGGAAGG - Intergenic
1114146112 14:19980023-19980045 GCAAGACTCCCAGCTGATGCTGG - Intergenic
1118751848 14:68813497-68813519 GCAGGACTCCCAGGAGAGGCAGG + Intergenic
1119329622 14:73784427-73784449 GCCAGGCTCCAGGGAGCTGCGGG - Intronic
1121109550 14:91303273-91303295 GAGAGGGTCTCAGGAGAGGCAGG - Intronic
1122954873 14:105065931-105065953 CCGAGCCTTCCAGGACATGCAGG - Intergenic
1202854704 14_GL000225v1_random:43240-43262 GCCAGGCACCCAGGACAGGCTGG + Intergenic
1123584701 15:21747338-21747360 GTGAGTATCCCAGCAGATGCAGG - Intergenic
1123621346 15:22189945-22189967 GTGAGTATCCCAGCAGATGCAGG - Intergenic
1125722922 15:41853693-41853715 GCCAGGCCCCCCGGAGCTGCAGG + Exonic
1126766900 15:52019033-52019055 GCAAAGCCCCCAGGAGACGCCGG + Intronic
1129189877 15:73931009-73931031 GCGAGGATCCCAGGAGAGGAGGG - Intronic
1129433562 15:75519437-75519459 TGGAGGTTCCCAGGAGGTGCTGG - Intronic
1129904101 15:79173726-79173748 GTGTGGCTGCTAGGAGATGCAGG + Intergenic
1131260216 15:90884157-90884179 GCGAGGCCCCAGGCAGATGCTGG - Intronic
1132293975 15:100721558-100721580 GGGATGCTCCCAGGAGCTGCTGG + Intergenic
1132640196 16:974688-974710 GCCACGCTCCCAGCAGCTGCGGG + Intronic
1132689451 16:1175976-1175998 GCCATGCTCCCAGGACATCCTGG + Intronic
1133238595 16:4401746-4401768 CAGAGGCTCTCAGGAGATGAAGG + Intronic
1134637868 16:15806407-15806429 TCGTGGCTGCCAGGAGCTGCGGG + Intronic
1136125297 16:28175184-28175206 GTGAGGCACCCAGGGGATGGGGG - Intronic
1137580911 16:49632931-49632953 GAGGGGCACCCAGGAGAAGCGGG + Intronic
1137597684 16:49735648-49735670 GGGAGTGTCCCAGGAGATGCAGG - Intronic
1139466061 16:67154852-67154874 GCGAGGCTGCCGGGCGCTGCGGG - Exonic
1139908467 16:70381952-70381974 GGGAGGCCCCGGGGAGATGCAGG + Intronic
1140109800 16:71994285-71994307 GGGAGGCTCCCAGGTGTTGGAGG - Intronic
1141870376 16:86781291-86781313 GTGAGCATCCCAGGAGATCCAGG + Intergenic
1141957913 16:87384499-87384521 GCGCGGCTCCCAGCAGCTGCAGG - Intronic
1142104645 16:88295688-88295710 GCCAGGCCCCCGGGAGATGCTGG + Intergenic
1143171386 17:4932546-4932568 GGGATGCTTCCAGGGGATGCAGG + Intronic
1143503630 17:7352346-7352368 GCGCGGGTCCCAGGAGATGGAGG - Exonic
1143886621 17:10069668-10069690 GATAGGCTCCCGGGAGATACTGG - Intronic
1143952053 17:10640781-10640803 GCCAAGGTCCCAGGAGATGAGGG + Intronic
1143965848 17:10756088-10756110 GCGAGGCTCCCAGGATGAGAAGG - Intergenic
1146630697 17:34467200-34467222 GAGAGGCCCTCATGAGATGCAGG + Intergenic
1147260998 17:39209838-39209860 GCGGGGCGCCAAGGAGAGGCGGG - Intergenic
1148538065 17:48457207-48457229 GGGAGGCGCCCAGGTGATGGGGG + Intergenic
1150263948 17:63819771-63819793 GCCAGGCTCCCAGGAGAGCATGG - Exonic
1151255991 17:72876982-72877004 GCCAGGCACCCAGCAAATGCAGG + Intronic
1151545474 17:74790373-74790395 GAGAGGCTCCCCGCAGATTCTGG + Intronic
1151765268 17:76130527-76130549 GCCAGGGTCCCAGGTGCTGCTGG - Intergenic
1152279802 17:79378677-79378699 GCCTGGCTCCCAGGTGAGGCTGG - Intronic
1152458598 17:80429884-80429906 GCCAGGCTCCCAGGAGCAGGCGG + Intronic
1152574963 17:81135950-81135972 GCGAGGTTTCCAGGATGTGCGGG + Intronic
1153581395 18:6577563-6577585 GCGAAGTCCCCAGGTGATGCAGG + Intronic
1154340787 18:13500471-13500493 GCGCTGCTCCCAGGAGGGGCGGG - Intronic
1154463236 18:14617596-14617618 GCAAGACTCCCAGCTGATGCCGG - Intergenic
1155213017 18:23619240-23619262 GGGAGGCCCCCAGGACAGGCGGG + Intronic
1155213026 18:23619260-23619282 GGGAGGCCCCCAGGACAGGCGGG + Intronic
1155257750 18:24014086-24014108 GCGGGGCTCCGGGGAGCTGCGGG + Intronic
1156297740 18:35808159-35808181 GCCTGGCTCCCAGCAGATGGTGG + Intergenic
1157377165 18:47177260-47177282 TTGATGCTCCCAGGAGATACAGG + Intergenic
1157599400 18:48884979-48885001 GCCAGCCTCCCAAGAGATGGAGG + Intergenic
1158474694 18:57769494-57769516 GCAAGGCTCCTTGGAGGTGCTGG + Intronic
1158477413 18:57792570-57792592 GAGAGGCTGCCAGGGGCTGCGGG + Intronic
1160920722 19:1519009-1519031 CCCAGGCTCCCAGGAGAAGGAGG + Intergenic
1160998734 19:1897848-1897870 GCAGGGCTCCCAGGAGAGGCGGG + Intergenic
1161370905 19:3910460-3910482 GGGAGGCTCCAAGGACAGGCTGG + Intronic
1161983292 19:7641608-7641630 GGACGGCTCCCAGGAGGTGCAGG + Intronic
1163636304 19:18438535-18438557 GTGTGGCTCCGAGGAGATTCTGG - Intergenic
1165170008 19:33885478-33885500 GCGCTGCTCCCAGAGGATGCTGG - Intergenic
1165296288 19:34928726-34928748 GGGAGGCTCCCAGGAGGTGGAGG + Intronic
1165782484 19:38442405-38442427 GCGAGCCCTGCAGGAGATGCTGG + Exonic
1166267018 19:41690681-41690703 CCGAGGGTCCCTGGAGATGGGGG - Intronic
1166646710 19:44537540-44537562 GAGAGGCTCCCAGGAGCTGAAGG + Intergenic
1166949440 19:46416672-46416694 GCGAGGCTGCAGGGAGATGGTGG + Intergenic
1167011676 19:46813016-46813038 GGGAGGCTCAGAGGAGAAGCAGG - Intergenic
1168061230 19:53893318-53893340 GTCAGGGTCCCAAGAGATGCAGG - Intronic
1168154135 19:54463798-54463820 GCCAGGCTCCCAAGAGCTCCGGG - Intergenic
925044849 2:765115-765137 TGGAGGCCCTCAGGAGATGCAGG - Intergenic
925128954 2:1481033-1481055 GCGAGTCCCCCGAGAGATGCCGG - Intronic
925969411 2:9096285-9096307 GCGAGTCTCCCAGGAAATGGGGG - Intergenic
926243910 2:11108005-11108027 GTGAGACTCCCTGGAAATGCAGG + Intergenic
926247615 2:11132753-11132775 GCGAGGCTCGCAAGAAATGGTGG - Intergenic
926365567 2:12129960-12129982 GGGAGTCTCCCAGAAGAGGCAGG - Intergenic
926914384 2:17878620-17878642 GCGAGGCTCCCGGGAGCTGCGGG - Intronic
927156070 2:20222592-20222614 GGGAGACTCCCTGGAGCTGCAGG - Intronic
927672656 2:25082103-25082125 GCAAGGCTGCCAGCAGCTGCAGG + Intronic
927708511 2:25311394-25311416 GGGCGGCTCCCTGGAGGTGCTGG + Intronic
927809487 2:26173471-26173493 GCGCGCCTCCCGGGAGACGCGGG + Intronic
928950902 2:36812264-36812286 CCCAGGCACCCAGAAGATGCTGG + Intronic
929492281 2:42407610-42407632 GCGGGGCTCCCTGGAGGAGCAGG - Intronic
929946174 2:46374243-46374265 GCGAGCCTACCAGGAGAACCGGG + Intronic
932432334 2:71683410-71683432 GGGAGGCTCCCTGGTGATCCGGG - Intronic
932756923 2:74415549-74415571 TCGAGGCTCCCAGGAGCAGATGG - Exonic
932888713 2:75571395-75571417 GAGGGGCTCCCAGGCAATGCTGG + Intergenic
933658256 2:84906292-84906314 GCGAGGCACCCACGAGGTGTGGG - Intronic
938067561 2:128289544-128289566 ACGAAGCTCCCAGGAGAACCCGG + Intronic
938068722 2:128295412-128295434 ACTAGGCTCCCAGCACATGCTGG + Intronic
940405423 2:153295711-153295733 GAGAAACTCCCAGGTGATGCTGG - Intergenic
942043981 2:172088377-172088399 GCGGGGCTCCGAGGAGATGGAGG - Exonic
942947042 2:181683227-181683249 GCGAGGCTCCCAGGAGATGCGGG + Intergenic
944406629 2:199392108-199392130 GGGTAGATCCCAGGAGATGCTGG + Intronic
946189972 2:218002987-218003009 GCGAGAGGCCCAGCAGATGCTGG - Intronic
947871416 2:233440908-233440930 GAGAGGCTGCCAGGAGGGGCTGG + Intronic
948097009 2:235343513-235343535 TCCAGGCTCCCAGGAGAGGGTGG - Intergenic
948538422 2:238666143-238666165 GCGAGGCTGCCAGGAGCAGGTGG - Intergenic
949046908 2:241876597-241876619 ACGAGGGTCCCAGGAGAAACTGG + Intergenic
949046945 2:241876704-241876726 ACGAGGGTCCCAGGAGAAACTGG + Intergenic
1169124173 20:3115270-3115292 CCAAGGCTCCAAGGAGATGGCGG + Intronic
1171383534 20:24751762-24751784 CTGGGGCTCCCAGGCGATGCTGG + Intergenic
1171395281 20:24829175-24829197 GCGTGGGGCCCAGGTGATGCAGG + Intergenic
1171408965 20:24933486-24933508 ACTGGGCTCCCAGGAGAGGCTGG - Intergenic
1171555795 20:26081687-26081709 GCGATGCTGGCTGGAGATGCGGG - Intergenic
1172272902 20:33664373-33664395 GGGACGCACCCAGGAGAAGCTGG + Intronic
1173115227 20:40235600-40235622 AGGAGGATCCCAGGAGATGTGGG - Intergenic
1174717664 20:52777215-52777237 GTGAGGCTGCCTTGAGATGCGGG + Intergenic
1175179631 20:57136342-57136364 GCAAGGCGCACAGGAGAAGCGGG - Intergenic
1175715659 20:61252931-61252953 GCGCGGCTCCCGGGCGATGGAGG - Intronic
1175863095 20:62160424-62160446 GAGAGGCTCCAGGGAGACGCAGG - Intronic
1176300042 21:5095112-5095134 GCCAGGGTCCCGGGAGCTGCAGG + Intergenic
1176301481 21:5101073-5101095 GGGGCCCTCCCAGGAGATGCAGG - Intergenic
1177788062 21:25693998-25694020 TTGAGGCTCCCAGTTGATGCTGG - Intronic
1178624642 21:34204607-34204629 GCGCGGCTGCCAGGGGCTGCTGG - Intergenic
1179855550 21:44160826-44160848 GGGGCCCTCCCAGGAGATGCAGG + Intergenic
1179856980 21:44166799-44166821 GCCAGGGTCCCGGGAGCTGCAGG - Intergenic
1180432385 22:15264140-15264162 GCGAGGCTCCCTGGAGCGGAAGG - Intergenic
1181670516 22:24423767-24423789 GCGAGGCCCGCAGGCGATCCTGG - Intronic
1182877443 22:33704516-33704538 GAGAGGCTCCCGGCAGATGAGGG - Intronic
1184282161 22:43443389-43443411 GCCAGGGTACCAGGAGAGGCTGG + Intronic
1185160800 22:49228596-49228618 GAGGGGCTCCCAGGACCTGCAGG + Intergenic
1185208362 22:49553084-49553106 ACGAGGCTCCCAGGACGTGTCGG - Intronic
1185402563 22:50626474-50626496 GAGGGGGTGCCAGGAGATGCTGG - Intronic
950078772 3:10206345-10206367 GCCAGGCTCCCAGCAGCTGGGGG + Intronic
950088811 3:10280246-10280268 AGGGGGCACCCAGGAGATGCGGG - Exonic
950190881 3:10975272-10975294 GTGATACACCCAGGAGATGCAGG - Intergenic
950295745 3:11828660-11828682 GGGAGGCTGCCAGGTGAAGCTGG + Intronic
950448944 3:13054916-13054938 GCGAGGCTCCCAGAAGCTGACGG + Intronic
952332477 3:32376958-32376980 GGGAGACTGCCAGGAGATGCAGG + Intergenic
953228762 3:41044698-41044720 GCTGGGCTCCCAGGAAATACAGG - Intergenic
953549929 3:43894310-43894332 GCGAGGCTGGCGGGAGATGCTGG - Intergenic
955809359 3:62770213-62770235 AAGAGCTTCCCAGGAGATGCTGG - Intronic
956094941 3:65706456-65706478 GCTTGGCACCCAGGAGGTGCTGG - Intronic
961089137 3:124094454-124094476 GCCAGGATGGCAGGAGATGCTGG + Intronic
961654186 3:128432607-128432629 GAGAGGCTCCCAGGAGAGGGTGG + Intergenic
962090672 3:132241185-132241207 GCTAGGATCCCAGGAGAAGGAGG - Intronic
962325246 3:134427192-134427214 GGGAGGCCCCCAGGTGAGGCAGG - Intergenic
962637004 3:137341370-137341392 CAGAGGCTCCCAGGGGATGCAGG - Intergenic
962685544 3:137844330-137844352 GTGATGCTCCCAGGATTTGCAGG + Intergenic
962808070 3:138940769-138940791 GAGAGCCTCCCAGGAGAAGAAGG - Intergenic
963107681 3:141660473-141660495 GCGAGGCTCCCTGGAGACCATGG + Intergenic
964868580 3:161288928-161288950 GAGAGCCTCCCTGGAGATCCAGG - Intergenic
965045950 3:163576762-163576784 GCTAGGCTCCCTCTAGATGCAGG + Intergenic
967759144 3:193204223-193204245 GAGAGGGTCCCAGGAAATGTGGG + Intergenic
967915303 3:194573905-194573927 GCGAGGCTGCTAGGAGCAGCTGG + Intergenic
967977558 3:195044043-195044065 GACTGGGTCCCAGGAGATGCAGG + Intergenic
968061544 3:195729780-195729802 GCGAGGTTCGCAGGGGCTGCAGG + Intronic
968405536 4:336864-336886 GCGGGGCCCCCAGGAGCTCCTGG + Intergenic
969478033 4:7432296-7432318 GCGGGGCACCCAGGAGAGTCTGG - Exonic
969536747 4:7760947-7760969 GCCAGGGTCCCCGGAGAAGCCGG - Exonic
970316277 4:14831380-14831402 CCGAGGCTCACAGGAGGAGCAGG + Intergenic
977954484 4:103011324-103011346 GCAAGGCTCCCAGGAGACATGGG - Intronic
978555294 4:109973251-109973273 GCGAGGCAGGCAGGAGATGACGG - Intronic
981821190 4:148889355-148889377 GCTGGGCTCTCAGGAGAGGCAGG + Intergenic
984860114 4:184230392-184230414 GTGAGGTCCCCAGAAGATGCTGG + Intergenic
985616573 5:926606-926628 GCGAGGGGCCCAGGAGGGGCGGG - Intergenic
986216028 5:5719982-5720004 GAGAGGCACCCAGGATGTGCAGG - Intergenic
986383043 5:7205819-7205841 GAGAGGCTGGCAGGAGAAGCAGG + Intergenic
987240661 5:15995376-15995398 GAGGGGCTCCCAGGAGGTGCTGG - Intergenic
987656963 5:20819558-20819580 GCCAGGGTCCCAGGAGACTCTGG + Intergenic
989825413 5:45848529-45848551 GAGAGGCACCCACAAGATGCTGG - Intergenic
991064748 5:62413015-62413037 GTGGGGCTACCAGGAGATGAGGG + Intronic
991587637 5:68216109-68216131 GCCCGGCGGCCAGGAGATGCCGG - Intronic
999247036 5:150160552-150160574 GCCAGGGTCCCAGGAGATAAAGG + Intergenic
1002898535 6:1392828-1392850 GCGAGGCTCCCAGGGAAGGCCGG - Intronic
1006385340 6:33727621-33727643 CAGAGGGTCCCTGGAGATGCAGG - Intronic
1006406318 6:33847751-33847773 GCCAGGCACCCAGGGGAGGCTGG + Intergenic
1009774618 6:68190300-68190322 ACGAGCCTTCCAGGTGATGCTGG + Intergenic
1010043518 6:71415589-71415611 GGAAGGCTCCAAGGAGAAGCTGG + Intergenic
1012160466 6:95878794-95878816 AAAAAGCTCCCAGGAGATGCTGG - Intergenic
1014233859 6:118934498-118934520 GCGGGGCTCCCGGCAGGTGCAGG - Intronic
1015391944 6:132692356-132692378 GTGAAGCTCACAGGAGTTGCAGG - Exonic
1016848871 6:148596177-148596199 GCAAGGCTCCAAGGAGAGGCTGG - Intergenic
1016876512 6:148870752-148870774 GAGAGCATCCCAGGAGATGGTGG - Intronic
1017662544 6:156687967-156687989 GGGGGGCTCCCGGGAGATGACGG - Intergenic
1018070680 6:160161728-160161750 GTGAGGATTCCAGGAGCTGCAGG + Intergenic
1018635301 6:165854895-165854917 CCGCGGGTCCCAGGGGATGCGGG + Intronic
1026775616 7:73229455-73229477 GCTATGCGCCCAGGAAATGCAGG + Intergenic
1027016475 7:74782827-74782849 GCTATGCGCCCAGGAAATGCAGG + Intronic
1027071554 7:75163109-75163131 GCTATGCGCCCAGGAAATGCAGG - Intergenic
1029425925 7:100493954-100493976 GCGAGGCTCCCGGGAGAGCCAGG - Exonic
1032017112 7:128387372-128387394 GCGAGGAAGCCAGGAGCTGCAGG - Intergenic
1037218237 8:16484305-16484327 GTTAGGGTCCCAGGAGATGAAGG - Intronic
1040452436 8:47561659-47561681 GGGAGGATCCCAGGAGGGGCAGG - Intronic
1041115439 8:54531405-54531427 GCAAGGCCCCCAAGAGATGTGGG + Intergenic
1041721967 8:60984069-60984091 GGGAGGGACCCAGGAGGTGCTGG - Intergenic
1043447646 8:80334856-80334878 GGGAGGATCCCAGGAGGTGGAGG - Intergenic
1047510703 8:125513225-125513247 GCGAGGCTCCCAGCAGCTCCTGG + Intergenic
1047765414 8:127986266-127986288 CCAAGGCTCCCAGGAGGTTCGGG - Intergenic
1047787957 8:128172529-128172551 CCAGGGCTCCCAGGAGAAGCTGG + Intergenic
1048234371 8:132675410-132675432 GCGAGGATCCCACGAGACCCGGG + Intronic
1048442382 8:134469491-134469513 GCGAGGCTTCCTTGAGGTGCTGG - Intergenic
1049169480 8:141150148-141150170 GGGAGGCCCTCAGGAAATGCTGG - Intronic
1049428961 8:142550501-142550523 GCCTGGCTCCCGGGAGAAGCAGG + Intergenic
1049603001 8:143516658-143516680 GCAGGGCTCCCAGGAGGGGCCGG - Intronic
1049905653 9:214567-214589 GCGAGGCTGCCAGGGAATGTAGG - Exonic
1052743991 9:32421668-32421690 GCGAAACTCCCAGGAGGTGGAGG + Intronic
1053266138 9:36714795-36714817 GAGAGGATTCCAGGAGATCCCGG - Intergenic
1053352859 9:37424811-37424833 GGGAGGCCCTCAGGAGAAGCAGG - Intronic
1055755872 9:79556756-79556778 GCAGGACTCCCAGGAGATCCAGG + Intergenic
1056604587 9:88076408-88076430 GCGTGGCGCCCCGGAGGTGCAGG + Intergenic
1056659858 9:88535653-88535675 CGGCAGCTCCCAGGAGATGCTGG + Exonic
1056743649 9:89282061-89282083 GCAAGGCTCTCATCAGATGCTGG + Intergenic
1056939994 9:90946839-90946861 GGGAGGATCCCAGGAGTTCCAGG + Intergenic
1059941863 9:119367588-119367610 AAGAGCCTCCCAGGAGATGGAGG + Intronic
1060243796 9:121926940-121926962 GCGAGGCTCTCATGAGAAGTCGG - Intronic
1060695803 9:125707805-125707827 GGGAGGTTTCCAGGAGATGTAGG + Intergenic
1061034606 9:128106693-128106715 GCAGGGCTCACAGGAGCTGCTGG - Intronic
1061584104 9:131555140-131555162 GGGAGGCTCCCTGGAGGTGGGGG + Intergenic
1061852003 9:133421870-133421892 GTGAGTCTTCCAGGAGATGAAGG + Intronic
1062144288 9:134980369-134980391 GCCAGTCTGCCTGGAGATGCGGG + Intergenic
1062267429 9:135693695-135693717 GCTTGGCTCCCAGGAGCTCCAGG - Exonic
1062291434 9:135797012-135797034 GCGAGGCTCCGGGCAGGTGCAGG - Intergenic
1062381890 9:136290713-136290735 GCGAGGGTCCCAGGAGCCCCCGG + Exonic
1185987658 X:4853830-4853852 CCCAGGATCCCAGGAGATGGAGG - Intergenic
1186326324 X:8481207-8481229 CCCAAGCTCCCAGGTGATGCTGG + Intergenic
1187275154 X:17810605-17810627 CCTAGCCTCCCAGGAGCTGCCGG + Intronic
1189259623 X:39669165-39669187 GTGAGGCTCCCAGGGGAGACTGG - Intergenic
1192214672 X:69150192-69150214 GCGGGGCTCCGAGGAGGTGGCGG + Intergenic
1198667144 X:139037107-139037129 GCGAGGCTTCAGGGAGATGTGGG - Intronic
1201175686 Y:11307355-11307377 GCCAGGCACCCGGGATATGCTGG + Intergenic