ID: 942947043

View in Genome Browser
Species Human (GRCh38)
Location 2:181683228-181683250
Sequence CGAGGCTCCCAGGAGATGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942947035_942947043 6 Left 942947035 2:181683199-181683221 CCGGCATCGCGACGCTCAGCCAG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 942947043 2:181683228-181683250 CGAGGCTCCCAGGAGATGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 159
942947033_942947043 15 Left 942947033 2:181683190-181683212 CCCGGGGCGCCGGCATCGCGACG 0: 1
1: 0
2: 14
3: 26
4: 42
Right 942947043 2:181683228-181683250 CGAGGCTCCCAGGAGATGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 159
942947034_942947043 14 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947043 2:181683228-181683250 CGAGGCTCCCAGGAGATGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942947043 Original CRISPR CGAGGCTCCCAGGAGATGCG GGG Intergenic
900237056 1:1597929-1597951 CAAGGGTCCCAGGGGATGTGGGG + Intergenic
900511157 1:3061819-3061841 CGAGGGTCCCAGGAGACAGGAGG + Intergenic
900616350 1:3567342-3567364 GGAGGATCCCAGGAGAGGCGAGG - Intronic
900940326 1:5794352-5794374 CAAGGCTCCCAAAAGATGCAGGG + Intergenic
900972382 1:5998721-5998743 CTGGGCTCCCAGGAGCAGCGAGG + Intronic
901741403 1:11344279-11344301 TGGGGCTCCGAGGAGATGGGTGG + Intergenic
904261497 1:29290241-29290263 GGAGGCTCCCAGGAAATGGTGGG - Intronic
904773895 1:32895257-32895279 AGGGGCTCCCAGGAAATTCGGGG + Intronic
906040832 1:42786623-42786645 GAAGGCTCCCAGGAGGGGCGAGG - Intronic
907384738 1:54118650-54118672 CGTGGCTCCCTGGAGAAGTGTGG - Intergenic
912818664 1:112849940-112849962 CGACGCTCCCGGGAGACGCGGGG - Intergenic
915288886 1:154869791-154869813 CGAGGGTCCCAGGGGCTGCTGGG + Exonic
918107303 1:181425875-181425897 GGAGGTCCCCAGGAGAGGCGGGG - Intronic
918240454 1:182615817-182615839 CCAGGCTCCTAGGAGCTGCTTGG - Intergenic
921079029 1:211724221-211724243 GGAGGATCCCAGGAGAGGCATGG - Intergenic
924756803 1:246948431-246948453 CGAGGCTGCGAGGAGATAAGGGG + Intronic
1063005266 10:1964555-1964577 CGAAGCCCCCAGGACACGCGAGG + Intergenic
1065600700 10:27365205-27365227 CGTGGTTGCCAGGAGATGGGAGG - Intergenic
1068857734 10:61814405-61814427 CGAGGCTACCAGAAGCTGAGAGG - Intergenic
1070912696 10:80132483-80132505 CCGGGCTCCCAGGAGGTGCGGGG + Intronic
1071492217 10:86143731-86143753 CCAGGCACCCAGGAGAGGCATGG + Intronic
1072562315 10:96587170-96587192 CGCGGCTCCCAGGAGCCGAGGGG - Intronic
1073442304 10:103559369-103559391 AGTGGCTCCCAGCAGATGCTGGG + Intronic
1074300120 10:112225959-112225981 GGAGGCTCCCAGGGGAGGTGGGG - Intergenic
1074699677 10:116082260-116082282 TGAAGCTCCCAGGAGATGTGCGG + Intronic
1075093904 10:119458720-119458742 CCAGGCTCCCGGGAGACGCATGG - Intronic
1076451444 10:130559764-130559786 CCAGGCTCCCAAGAGCTGCGTGG - Intergenic
1077409559 11:2397152-2397174 AGTGGCTCCCAGGAGAGGCCTGG - Exonic
1079126732 11:17722580-17722602 CGAGGCCCCCAAGTGATGCCTGG - Intergenic
1080433507 11:32219420-32219442 CCAGGCTCCCATGAGGTTCGGGG - Intergenic
1080927936 11:36777502-36777524 CGAGGCTTCCAGGACTTGCAGGG - Intergenic
1081561549 11:44221653-44221675 AGATGCTCCAAGGAGATGTGTGG + Intronic
1083204188 11:61138186-61138208 CCAGGGTCACAGGAGATGCTAGG + Intronic
1084544821 11:69810014-69810036 GGAGCCTCCCAGGAGCAGCGGGG - Intergenic
1090657786 11:128859342-128859364 GGAGGATCCCATGAGATGGGAGG - Intronic
1091057248 11:132430506-132430528 CATGGCTCCCAGGAGCCGCGAGG + Intronic
1091595554 12:1876541-1876563 TGAGGCCCCCAGCAGATGCCTGG + Intronic
1094818727 12:34209081-34209103 CCAGGAGCCCAGGACATGCGGGG + Intergenic
1094872424 12:34605766-34605788 CGAGGGTCCCAGGGGATCCTCGG + Intergenic
1103869649 12:124082284-124082306 CCAGGTTCCCAGTAGATACGCGG - Intronic
1103941705 12:124504850-124504872 CGAGGCTGCCAGGGGTTGTGGGG + Intronic
1104844201 12:131838676-131838698 CCAGGCTCGCAGGAGACGCCAGG + Exonic
1107654109 13:42574340-42574362 CGTGGCTCGGAGGAGATGGGCGG + Exonic
1113413409 13:110109590-110109612 CGAGGGACCCAGGAGATTTGTGG - Intergenic
1118859618 14:69652516-69652538 CGTGGCTCCCAGGTGCTGCGTGG - Intronic
1122367500 14:101202842-101202864 CAGGGCTCCCAGAAGATGCCAGG - Intergenic
1122575376 14:102738586-102738608 TGAGGCTCCAAGGAGCTGCCAGG - Intergenic
1125546175 15:40507275-40507297 CGAGGCGCCCGGGAAACGCGAGG - Intergenic
1130014060 15:80173918-80173940 AGAGGCCCCCAGCAAATGCGTGG - Intronic
1132293976 15:100721559-100721581 GGATGCTCCCAGGAGCTGCTGGG + Intergenic
1132664125 16:1073892-1073914 CGAGGCTGTCAGGAGGTGCCTGG + Intergenic
1133022701 16:2973925-2973947 CGGGGCTCCATGGAGATTCGTGG - Intronic
1133238596 16:4401747-4401769 AGAGGCTCTCAGGAGATGAAGGG + Intronic
1134195453 16:12156076-12156098 CAAGGCTTCAAGGAGATGTGGGG - Intronic
1137597683 16:49735647-49735669 GGAGTGTCCCAGGAGATGCAGGG - Intronic
1140123909 16:72104955-72104977 CTGGGCTCCCAGGAGATGCCCGG + Intronic
1140952939 16:79836487-79836509 CCAGGCACCCAGCAGATGCCTGG + Intergenic
1141421166 16:83917488-83917510 CGAGGGTCACAGGAGATGAAAGG - Exonic
1141618224 16:85222025-85222047 CCAGGCTCCCAGCAGACCCGAGG - Intergenic
1141625447 16:85258996-85259018 GGAGGCCCCCAGGAGCTGCCAGG + Intergenic
1142104647 16:88295689-88295711 CCAGGCCCCCGGGAGATGCTGGG + Intergenic
1143036195 17:4000521-4000543 CGAGGCTCACAGTGGCTGCGTGG + Intergenic
1143068455 17:4268333-4268355 CGAGGCTCCCAGGAAAGATGTGG - Intergenic
1144695073 17:17298214-17298236 TGTGGGTCCCAGGAGATGAGGGG - Intergenic
1146943601 17:36859948-36859970 TGAGGCTCCCAGGAGGGGGGTGG + Intergenic
1147142274 17:38466455-38466477 CGGGGCTCCGAGGAGAGGTGGGG - Exonic
1150638568 17:66933845-66933867 GGAGGCTCCCAGGAGACCCTTGG + Intergenic
1152360894 17:79832553-79832575 AGAGGCTCCCACTAGAGGCGCGG - Intergenic
1152638433 17:81439647-81439669 CCGGGCTCCCAGGAGCTGTGCGG - Intronic
1153653212 18:7259913-7259935 GGAGGCTCCCAGCAGCCGCGAGG - Intergenic
1154209016 18:12363193-12363215 TGAGGCTCCCAGGACTTGCTAGG - Intronic
1155257751 18:24014087-24014109 CGGGGCTCCGGGGAGCTGCGGGG + Intronic
1158397258 18:57088978-57089000 CCAAGCTCCCAGGTGATGCCAGG - Intergenic
1158477414 18:57792571-57792593 AGAGGCTGCCAGGGGCTGCGGGG + Intronic
1160998735 19:1897849-1897871 CAGGGCTCCCAGGAGAGGCGGGG + Intergenic
1161320059 19:3636992-3637014 CCAGGCTCCCAGGGGAGCCGAGG + Intronic
1161991003 19:7684192-7684214 CGAGGCCCCCAGGGGATTCCTGG + Exonic
1163633473 19:18428281-18428303 GCAGGCTCACATGAGATGCGGGG - Intronic
1163810428 19:19428309-19428331 CCAGGCTCCCAGCAGCTGCCTGG - Intronic
1164372562 19:27655016-27655038 AGAGGCACACAGGAGATGCTAGG - Intergenic
1165426047 19:35746005-35746027 CTAGGGTCCCAGGAGAAGAGAGG + Intronic
1166916108 19:46196950-46196972 TGTGGCTCCCAGGAGATCCCAGG + Intergenic
1167250986 19:48398378-48398400 CGGGGCCCGCAGGCGATGCGCGG + Exonic
926272362 2:11376304-11376326 CCAAGCTCTCAGGGGATGCGAGG - Intergenic
927809488 2:26173472-26173494 CGCGCCTCCCGGGAGACGCGGGG + Intronic
928201318 2:29249422-29249444 AGAGGCTTCCAGGAGGTGGGTGG + Intronic
929588467 2:43130584-43130606 CTGGGCTCCCAGGAGGTGAGGGG + Intergenic
929946175 2:46374244-46374266 CGAGCCTACCAGGAGAACCGGGG + Intronic
931828320 2:66024637-66024659 CTTGGCTCCCAGGAGAGGAGGGG + Intergenic
933658255 2:84906291-84906313 CGAGGCACCCACGAGGTGTGGGG - Intronic
936889212 2:117349641-117349663 CAAGGCTCCCAGAAGATTCATGG - Intergenic
938068723 2:128295413-128295435 CTAGGCTCCCAGCACATGCTGGG + Intronic
942043980 2:172088376-172088398 CGGGGCTCCGAGGAGATGGAGGG - Exonic
942451762 2:176112560-176112582 CGAGGCTCCAACGAGTGGCGTGG + Intronic
942947043 2:181683228-181683250 CGAGGCTCCCAGGAGATGCGGGG + Intergenic
948462991 2:238139178-238139200 CGAGGCCCCCAGGGGAAGTGGGG + Intronic
948621462 2:239237678-239237700 CAAGGGTCCCAGGAGATTGGAGG + Intronic
1169124174 20:3115271-3115293 CAAGGCTCCAAGGAGATGGCGGG + Intronic
1171061334 20:21964998-21965020 CGAGGTTACCAGGAGCTGAGGGG - Intergenic
1171408964 20:24933485-24933507 CTGGGCTCCCAGGAGAGGCTGGG - Intergenic
1171979832 20:31619921-31619943 CGAGGCTGCCAGGGGATGGCAGG - Intergenic
1172272676 20:33663442-33663464 CGAGGGTCCCAGGAGAAGCGCGG + Intronic
1173853156 20:46231750-46231772 CCAGTCTCCATGGAGATGCGAGG - Intronic
1175248136 20:57593496-57593518 CGAGGGGCCCATGAGATGTGGGG + Intergenic
1176379575 21:6105360-6105382 CGTGGGTCCCAGGAGGTGTGTGG + Intergenic
1176515083 21:7777799-7777821 TGAAACTCCCAGGAGATGCCTGG - Intergenic
1178649111 21:34407811-34407833 TGAAACTCCCAGGAGATGCCTGG - Intronic
1179174613 21:38999416-38999438 CGTGGTTACCAGGAGATGAGAGG + Intergenic
1179743899 21:43432877-43432899 CGTGGGTCCCAGGAGGTGTGTGG - Intergenic
1180212289 21:46302113-46302135 CGAGGGTCCCACGAGCTGCCAGG - Exonic
1184225711 22:43127947-43127969 GGGGGCTCCCAGGAGAGGTGCGG - Intronic
1184357125 22:43989883-43989905 AGAGACTCCCAGCAGATGCCTGG + Intronic
1184492069 22:44815488-44815510 CGACTCTCCCAGGAGCTGAGAGG + Intronic
1184980076 22:48089669-48089691 AGATGCTCTCAGGATATGCGGGG - Intergenic
1185208361 22:49553083-49553105 CGAGGCTCCCAGGACGTGTCGGG - Intronic
950452652 3:13073822-13073844 CAAGACTCCCAGGAGAGACGCGG - Intergenic
953549928 3:43894309-43894331 CGAGGCTGGCGGGAGATGCTGGG - Intergenic
954428648 3:50457505-50457527 AGAGGTTTCCAGGAGCTGCGGGG - Intronic
954567481 3:51610739-51610761 CCAGGCTCTCTGGAGATGCTAGG + Intronic
955327467 3:58020362-58020384 CGAGGCTACCTGCAGATGAGCGG - Intronic
956227084 3:66972458-66972480 CGAGACTCCGAGGAGATGTCTGG + Intergenic
957474564 3:80706451-80706473 AGTGCCTCCCAGGACATGCGGGG + Intergenic
962637003 3:137341369-137341391 AGAGGCTCCCAGGGGATGCAGGG - Intergenic
966742428 3:183246356-183246378 AGAGGTTCCCAGGAGCTGTGGGG - Intronic
968235763 3:197029399-197029421 CGACGCTCCAAGGAGAAGCGCGG - Intronic
968427750 4:534671-534693 CGAAGCTGCCAGGAGACGGGTGG - Intronic
969404875 4:6984329-6984351 CGAAGCTCCCATGGGATGCCAGG - Intronic
969675010 4:8609837-8609859 CCAGGGTCCCAGGAGAGGCCTGG + Intronic
974716032 4:65669735-65669757 GGAGGCTCGGAGAAGATGCGGGG - Exonic
977954483 4:103011323-103011345 CAAGGCTCCCAGGAGACATGGGG - Intronic
978143251 4:105341680-105341702 CGAGGCAAACAGGAGAGGCGAGG - Intergenic
982062360 4:151617073-151617095 CCTGGCTCCCAGGAGAAGAGAGG + Intronic
982198543 4:152937829-152937851 CGCGGCTCCCCGGGGATTCGCGG + Intronic
985047818 4:185958007-185958029 CCTGGCTCCCAGGAGTTGAGTGG - Intergenic
985511320 5:315753-315775 CCAGGCTCCCTGGGGATGGGAGG + Intronic
985549245 5:524730-524752 CGGGCATCCCAGGAGCTGCGCGG - Intergenic
987240660 5:15995375-15995397 AGGGGCTCCCAGGAGGTGCTGGG - Intergenic
999195415 5:149778417-149778439 GGAGGCTCCAAGCAGAAGCGGGG + Intronic
999388913 5:151175716-151175738 ACAGGCTCCCAGGTGATGCTTGG - Intergenic
1003569819 6:7248411-7248433 TGAGGCTCCCAGGCTATGTGCGG - Intronic
1011548941 6:88511374-88511396 GAAGGCTTCCAGGAGATGAGTGG - Intergenic
1014001346 6:116370043-116370065 CCAGGCCCCAAGGAGATGTGAGG - Intronic
1016828187 6:148407244-148407266 GGTGGCTGCCAGGAGATGTGAGG - Intronic
1016848870 6:148596176-148596198 CAAGGCTCCAAGGAGAGGCTGGG - Intergenic
1018696549 6:166395898-166395920 TGAGGCTACTAGGACATGCGGGG - Intergenic
1018711027 6:166498348-166498370 GGAGGCTGCCAGGAAATGCTTGG + Intronic
1019187747 6:170230734-170230756 CGAGGAGCCCAGGACCTGCGTGG + Intergenic
1019289842 7:245101-245123 GGATGCTCCCAGGAGTTGGGCGG + Intronic
1019899295 7:4007411-4007433 CGAGGCTTCCTGTAGATGAGGGG - Intronic
1022787381 7:33652075-33652097 CAAGGCTCCCTGGAAATGCCAGG - Intergenic
1026505145 7:70976301-70976323 TGAGACTACCAGGAGATGCTTGG + Intergenic
1029458370 7:100682292-100682314 AGCGGCTCCCAGGAGGTGGGCGG - Intronic
1031390096 7:121203293-121203315 CCAGGCTCCCAGGAGAAAGGAGG - Intronic
1032683250 7:134207319-134207341 CGAGGTTACCAGGAGTTGAGGGG - Intronic
1034263078 7:149769132-149769154 CGAGGCTCCCTGCAGAGGCCAGG - Exonic
1035161004 7:156949914-156949936 CGAGGCTCCCGGGGGTTGCGAGG + Exonic
1035277955 7:157759157-157759179 CGATGCTCCCAGGAGAGGGAAGG - Intronic
1035685340 8:1519934-1519956 CGAGGCTCCCAGGGCAGGTGTGG - Intronic
1038481106 8:27902328-27902350 CGGGGCTCCCTGGGGATGGGTGG - Intronic
1041044695 8:53879377-53879399 CGAGGCTCCCCGGAGGCGCCTGG + Exonic
1041048841 8:53913680-53913702 CGAGGCTGCCAGAAGAGGCAAGG + Intronic
1047529489 8:125662244-125662266 TGAGGCTCAAAGGAGATGTGGGG + Intergenic
1047765413 8:127986265-127986287 CAAGGCTCCCAGGAGGTTCGGGG - Intergenic
1048443883 8:134479009-134479031 CGGGGCTTCCAGGAGGTGTGGGG + Intronic
1048524350 8:135187653-135187675 CGAGGCTCCAGGGAGGTGAGGGG - Intergenic
1049463157 8:142739352-142739374 CGACCCTCCCAGGAAATGCGTGG - Intergenic
1049584337 8:143425944-143425966 CTAGGGTCCCAGGAGCTGAGCGG + Intronic
1049740633 8:144239309-144239331 GGAGGCTCGCTGGAGATGAGAGG - Exonic
1049747132 8:144267713-144267735 AGAGGCTGGCAGGAGATGTGGGG + Intronic
1052613467 9:30807382-30807404 CGAGGTTTCCAGGAGTTGAGGGG + Intergenic
1062077069 9:134595228-134595250 GGAGGCCCCCAGGAGAGGTGGGG + Intergenic
1062144290 9:134980370-134980392 CCAGTCTGCCTGGAGATGCGGGG + Intergenic
1185725891 X:2421509-2421531 CTGGTCTCCCTGGAGATGCGTGG - Intronic
1190929134 X:54933638-54933660 CGAGGCACCATGGAGATGCAAGG - Intronic