ID: 942947046

View in Genome Browser
Species Human (GRCh38)
Location 2:181683236-181683258
Sequence CCAGGAGATGCGGGGTAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942947033_942947046 23 Left 942947033 2:181683190-181683212 CCCGGGGCGCCGGCATCGCGACG 0: 1
1: 0
2: 14
3: 26
4: 42
Right 942947046 2:181683236-181683258 CCAGGAGATGCGGGGTAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 100
942947035_942947046 14 Left 942947035 2:181683199-181683221 CCGGCATCGCGACGCTCAGCCAG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 942947046 2:181683236-181683258 CCAGGAGATGCGGGGTAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 100
942947034_942947046 22 Left 942947034 2:181683191-181683213 CCGGGGCGCCGGCATCGCGACGC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 942947046 2:181683236-181683258 CCAGGAGATGCGGGGTAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 100
942947037_942947046 -5 Left 942947037 2:181683218-181683240 CCAGTGCCCGCGAGGCTCCCAGG 0: 1
1: 0
2: 1
3: 27
4: 222
Right 942947046 2:181683236-181683258 CCAGGAGATGCGGGGTAGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942947046 Original CRISPR CCAGGAGATGCGGGGTAGTA AGG Intergenic
900199542 1:1398045-1398067 TCAGTAGATGCGGTTTAGTAAGG - Intronic
900522990 1:3115187-3115209 CCAGGAGAGGCGGGGTCACAGGG - Intronic
904609261 1:31716002-31716024 CCTGGAGATGGGGGGAAGAAGGG - Intergenic
905464078 1:38139684-38139706 ACAGGGGGTGCTGGGTAGTAAGG - Intergenic
906509182 1:46401118-46401140 CCAGGGGAGGAGGGGGAGTAGGG + Intronic
907403792 1:54241484-54241506 CCAGGTGATGAGGAGGAGTATGG + Exonic
911563172 1:99431053-99431075 CCAGGGTATGTGGGGTAGGAGGG + Intergenic
913295021 1:117310928-117310950 CCAGGACATGGGAGGAAGTATGG + Intergenic
913485916 1:119332740-119332762 CCAGGAAATGCGGGGGAGAGGGG + Intergenic
921551679 1:216544423-216544445 TCAGGAGATCCAGGGTTGTAAGG + Intronic
1064438412 10:15331402-15331424 CCAGGAGAGGCCAGGTAGTATGG - Intronic
1064613521 10:17128548-17128570 ACAGGGGATGCGAGGAAGTAGGG - Intronic
1072001323 10:91198490-91198512 CCAGGAGAGTAGGGGTACTAGGG - Intronic
1074359775 10:112816093-112816115 CCAGCAGATTCTGGGGAGTATGG - Exonic
1079804227 11:24909923-24909945 CAAGAAGATGTGGGGTAGTTTGG + Intronic
1080016893 11:27517086-27517108 CCAGAAGTTGTGGTGTAGTATGG - Intergenic
1081867403 11:46367223-46367245 CCAGGAGGTGGGAGGAAGTAGGG + Intronic
1083862550 11:65430215-65430237 CCAGGGGAGGCGGGGAAGGAGGG - Intergenic
1084360135 11:68663907-68663929 CCAGGAGATGAGGGGTACGGTGG - Intergenic
1084544817 11:69810006-69810028 CCAGGAGCAGCGGGGCAGTGTGG - Intergenic
1087073970 11:94111548-94111570 CCAGGAGATGTGGTGGAGTAAGG - Exonic
1090073162 11:123561524-123561546 CAAGGAGGTGTGGGGGAGTAAGG - Intronic
1090118017 11:123995348-123995370 TCAGGAGTTGAGGGGGAGTAAGG - Intergenic
1092980442 12:13789428-13789450 CCAGGGGATGCAGGGGAGTGGGG - Intronic
1093113850 12:15185454-15185476 CCAGGAGATCCAGGGGAGTGAGG - Intronic
1100281773 12:93125157-93125179 CCAGGAGATGTTGGGTGGTCAGG - Intergenic
1104481432 12:129111263-129111285 CCAGGAGATGGGGGGAGGCAGGG + Intronic
1105917287 13:24928268-24928290 CCAGGTGATCCGGGCTAGAAAGG + Intergenic
1109050227 13:57471073-57471095 CCAGGACATGAGGAGTAGGAAGG - Intergenic
1114037693 14:18645417-18645439 CCAGGTGATGAGGAGGAGTATGG + Intergenic
1114120941 14:19669604-19669626 CCAGGTGATGAGGAGGAGTATGG - Intergenic
1120704363 14:87732039-87732061 TCAGGAGATGAGGGGTAGAAAGG - Intergenic
1124347463 15:28932146-28932168 CAATGAGATGAGGGGTAGGAGGG + Intronic
1129644477 15:77418275-77418297 ACAGGAGATGGGGGGTAGTGAGG + Intronic
1131695693 15:94875739-94875761 CCAGGAGCTGCGGGCTAGAGTGG - Intergenic
1132205026 15:99980565-99980587 TCAGGAGATGCAGGGGAGTGAGG - Intronic
1133185741 16:4097110-4097132 CCAGGAAATGTGGGGTTGAACGG - Intronic
1136491179 16:30609604-30609626 CCAGGAGATGAGGGCTGGTTTGG + Exonic
1137875270 16:51990707-51990729 TCAGGAGATGGAGGGTAGGAGGG - Intergenic
1139599563 16:67978469-67978491 CCAGCAGATGAGAGGTAGTCAGG - Intronic
1141649001 16:85382593-85382615 CCCGGAGATGCTGGGTAAGATGG + Intergenic
1144681335 17:17197479-17197501 CCAGGAGCTGGAGGGTAGTACGG + Intronic
1151291215 17:73151394-73151416 CCAGGAGATGGGGTTTATTAGGG + Intergenic
1153001849 18:463019-463041 TCAGGAGAAGCGGGGGAGTCAGG + Intronic
1154173534 18:12067546-12067568 CCAGGGGATGAGGAGGAGTAGGG + Intergenic
1155971954 18:32091912-32091934 CCAGGAGAGGCGGGGAGGCACGG - Exonic
1161062402 19:2221859-2221881 CCAGGAGAGGCGGGGAAGTGGGG - Intronic
1161293138 19:3506425-3506447 CCAGGAGAGGCGGGGTCGGCGGG + Intronic
1164705864 19:30319194-30319216 CTAGGAGATGCCGGGAAGTTGGG + Intronic
1164998238 19:32739329-32739351 CCAGGAGATGCAGAGTAGCCAGG - Intronic
1165808675 19:38597192-38597214 CCAGAAGATGGGTGGTAGTGTGG - Intronic
1166372654 19:42310661-42310683 CCAGGAGAGGCTGGGCAGTGGGG - Exonic
1166391216 19:42409874-42409896 CCTGGAGATGTGGGGTGGGAGGG + Intronic
1168149255 19:54436065-54436087 CTAGGAGATTCGGGGTAGCGGGG - Intronic
925012921 2:499421-499443 CCAGCAGATGGGAGGTTGTAGGG + Intergenic
925362049 2:3286446-3286468 CCAGGACATGCCTGGTAGGATGG - Intronic
927815236 2:26210002-26210024 CCTGGGGATGCGGGGGAGTTTGG + Intronic
928105391 2:28467533-28467555 TCAGAAGGTGTGGGGTAGTAGGG + Intronic
930152300 2:48070977-48070999 CCAGGAGCTGCGGAGTAGGGAGG - Intergenic
933430115 2:82165633-82165655 CCAGGATATGCAGAGTAGAATGG - Intergenic
936464436 2:112734664-112734686 GCAGGAAATGGGTGGTAGTAGGG + Intronic
938273280 2:129993646-129993668 CCAGGTGATGAGGAGGAGTATGG - Intergenic
939026989 2:137025782-137025804 CAAGGAGATTGGGGGTAATAGGG + Intronic
939437119 2:142191976-142191998 CCAGGAGTAGGAGGGTAGTAGGG - Intergenic
940361115 2:152797167-152797189 GCAGGGGATGCAGGGAAGTAGGG + Intergenic
942540619 2:177011781-177011803 CCAGGAGAGGCGGGGATGTAAGG - Intergenic
942947046 2:181683236-181683258 CCAGGAGATGCGGGGTAGTAAGG + Intergenic
945798516 2:214394868-214394890 CCAGGAGTTGTGGGGAGGTAGGG - Intronic
946122811 2:217531161-217531183 CCAGGAGATGGAGGGCAGTCGGG - Intronic
946306965 2:218861539-218861561 CCAGGAGAAGCTGGGTTGTGAGG - Intronic
946425604 2:219594111-219594133 CCAGGAAACTCGGGGTGGTAGGG + Intergenic
946639904 2:221773095-221773117 GCAGGGGATGTGGGGTATTAAGG + Intergenic
1170407026 20:16049146-16049168 CCAGCAGGAGTGGGGTAGTAGGG + Intronic
1170890831 20:20373906-20373928 CCAGGAGATGAAGGGCAGTGAGG + Intergenic
1171216160 20:23353965-23353987 CCAGGGGCTGCAGGGAAGTAAGG - Exonic
1175874762 20:62224131-62224153 CCAGGAGAGGAGGGGTGGGAGGG + Intergenic
1178294087 21:31394336-31394358 CCAGGAGATGGGGGAAAGGAGGG + Intronic
1178670848 21:34590524-34590546 TCAGGAGATGCAGTGTAGAAAGG - Intronic
1180461822 22:15572459-15572481 CCAGGTGATGAGGAGGAGTATGG + Intergenic
1181372237 22:22427745-22427767 CCAGGAGATGCGGAGGAGGAAGG - Intergenic
1182822088 22:33225199-33225221 CCAGGAGAGGCAAGGTAGGACGG + Intronic
952235961 3:31480490-31480512 CCAGGAACTGCGGGGTAGTTTGG - Intergenic
959484691 3:106913395-106913417 CCAGGAGATGCGGGCTGGAGCGG + Intergenic
961345689 3:126261866-126261888 TCAGGTGATGCTGGGTAGAAAGG - Intergenic
971373183 4:26034663-26034685 GCAGGAGATGAGGGGTTGGAAGG - Intergenic
974099766 4:57403697-57403719 CCAGGTGATGCAGGGTATTTAGG + Intergenic
977273139 4:94943067-94943089 CCAGTATATGCAGAGTAGTATGG + Intronic
978443468 4:108758738-108758760 CCAAGAGATGCGGGCTGGTCTGG - Intronic
990719417 5:58676587-58676609 ACTGGAGGTGCGGGGTGGTAGGG + Intronic
992915545 5:81448800-81448822 CCAGGAGATGCTGAGGAGTATGG + Exonic
997469393 5:134108506-134108528 CCAGGACAACAGGGGTAGTAGGG - Intergenic
998399572 5:141841593-141841615 CCAGCAGATGCAGGGCAGCAGGG - Intergenic
999256195 5:150211160-150211182 CCAGGAGAGCCGGGGAAGGAGGG - Intronic
999388909 5:151175708-151175730 CCAGGTGATGCTTGGTAGTAGGG - Intergenic
1010971112 6:82264350-82264372 CCAGGAGATGTTGAGGAGTATGG + Intergenic
1015248540 6:131102842-131102864 CCAGGAGCTGGTGGGTAATAGGG - Intergenic
1021500993 7:21330892-21330914 CTCGGAGATGCGGGGTAGAGGGG + Intergenic
1032075934 7:128836229-128836251 TCAGGAGATGAGGGGCAGAAAGG - Intronic
1033222980 7:139540842-139540864 CCAGGAGTTGGGGGCTAGTCTGG + Intronic
1033896268 7:146074162-146074184 CCAGGAGGGGCGGGGGGGTATGG + Intergenic
1034018820 7:147617638-147617660 CAAAGAGATGCAGGGTAGTAAGG + Intronic
1034299219 7:150000761-150000783 CCAGGAGCTGCGGGCTGGGAAGG - Intergenic
1034806796 7:154096012-154096034 CCAGGAGCTGCGGGCTGGGAAGG + Intronic
1038906975 8:31915949-31915971 CCAGAATATGCTTGGTAGTAAGG - Intronic
1039352905 8:36781892-36781914 ACAGGAGAGGTGGGGCAGTATGG - Intergenic
1044354658 8:91207135-91207157 CCAGGAGAAGTGGGATAATAAGG + Intronic
1045486746 8:102637335-102637357 CCAAGAGATGCAGGGTGGTTTGG + Intergenic
1048603274 8:135941820-135941842 CCAGGAGATTCTGGGAAGAAGGG + Intergenic
1050907272 9:11020530-11020552 GCAGGAGATGTGGCATAGTATGG - Intergenic
1052271447 9:26632221-26632243 CCAGGTGATGACAGGTAGTATGG + Intergenic
1054713197 9:68532007-68532029 CTAGGAGATGAGGGTTAGGATGG + Intergenic
1055108908 9:72540270-72540292 CCAGGAAATGGGGGGTAGGAAGG + Intronic
1055558637 9:77500927-77500949 CCAGGAGTAGCTGGGTTGTATGG + Intronic
1199074780 X:143514799-143514821 CCTGAAGATTCGGGGTGGTAAGG - Intronic