ID: 942950379

View in Genome Browser
Species Human (GRCh38)
Location 2:181714346-181714368
Sequence GCTGCTGCTGGAGCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942950377_942950379 1 Left 942950377 2:181714322-181714344 CCTATAGAAGAGGAGTAAATTGC No data
Right 942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942950379 Original CRISPR GCTGCTGCTGGAGCACAAGC AGG Intergenic
No off target data available for this crispr