ID: 942950855

View in Genome Browser
Species Human (GRCh38)
Location 2:181719661-181719683
Sequence CCTTCCACAGATTAGTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942950846_942950855 20 Left 942950846 2:181719618-181719640 CCTCATCTCCATAACTCAGCAGC No data
Right 942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG No data
942950847_942950855 12 Left 942950847 2:181719626-181719648 CCATAACTCAGCAGCCCCAATCC No data
Right 942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG No data
942950845_942950855 21 Left 942950845 2:181719617-181719639 CCCTCATCTCCATAACTCAGCAG No data
Right 942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG No data
942950848_942950855 -2 Left 942950848 2:181719640-181719662 CCCCAATCCTTCATCGTATTCCC No data
Right 942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG No data
942950849_942950855 -3 Left 942950849 2:181719641-181719663 CCCAATCCTTCATCGTATTCCCT No data
Right 942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG No data
942950851_942950855 -9 Left 942950851 2:181719647-181719669 CCTTCATCGTATTCCCTTCCACA No data
Right 942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG No data
942950850_942950855 -4 Left 942950850 2:181719642-181719664 CCAATCCTTCATCGTATTCCCTT No data
Right 942950855 2:181719661-181719683 CCTTCCACAGATTAGTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942950855 Original CRISPR CCTTCCACAGATTAGTTTTA GGG Intergenic
No off target data available for this crispr