ID: 942950981

View in Genome Browser
Species Human (GRCh38)
Location 2:181721267-181721289
Sequence CTTGATCTCCAGATGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942950981_942950985 11 Left 942950981 2:181721267-181721289 CCAGGTGCCATCTGGAGATCAAG No data
Right 942950985 2:181721301-181721323 TGTGCCTTGAGACATTCTATTGG No data
942950981_942950987 20 Left 942950981 2:181721267-181721289 CCAGGTGCCATCTGGAGATCAAG No data
Right 942950987 2:181721310-181721332 AGACATTCTATTGGTTAGAAAGG No data
942950981_942950988 30 Left 942950981 2:181721267-181721289 CCAGGTGCCATCTGGAGATCAAG No data
Right 942950988 2:181721320-181721342 TTGGTTAGAAAGGCAGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942950981 Original CRISPR CTTGATCTCCAGATGGCACC TGG (reversed) Intergenic
No off target data available for this crispr