ID: 942951666

View in Genome Browser
Species Human (GRCh38)
Location 2:181728810-181728832
Sequence GAGGCTGATGGGAGCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942951666_942951678 11 Left 942951666 2:181728810-181728832 CCTCCATGGCTCCCATCAGCCTC No data
Right 942951678 2:181728844-181728866 GGATCTTAGAGGGAAGTTAGTGG No data
942951666_942951679 23 Left 942951666 2:181728810-181728832 CCTCCATGGCTCCCATCAGCCTC No data
Right 942951679 2:181728856-181728878 GAAGTTAGTGGAACACATTATGG No data
942951666_942951672 -10 Left 942951666 2:181728810-181728832 CCTCCATGGCTCCCATCAGCCTC No data
Right 942951672 2:181728823-181728845 CATCAGCCTCCCTTCATGAGGGG No data
942951666_942951677 1 Left 942951666 2:181728810-181728832 CCTCCATGGCTCCCATCAGCCTC No data
Right 942951677 2:181728834-181728856 CTTCATGAGGGGATCTTAGAGGG No data
942951666_942951676 0 Left 942951666 2:181728810-181728832 CCTCCATGGCTCCCATCAGCCTC No data
Right 942951676 2:181728833-181728855 CCTTCATGAGGGGATCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942951666 Original CRISPR GAGGCTGATGGGAGCCATGG AGG (reversed) Intergenic
No off target data available for this crispr