ID: 942953586

View in Genome Browser
Species Human (GRCh38)
Location 2:181749792-181749814
Sequence GCCCCTTTGCTGCAGGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942953584_942953586 -8 Left 942953584 2:181749777-181749799 CCTTCTAACAGTCAGGCCCCTTT No data
Right 942953586 2:181749792-181749814 GCCCCTTTGCTGCAGGTCGCTGG No data
942953582_942953586 11 Left 942953582 2:181749758-181749780 CCTTCTGTTTGTTAGTTTTCCTT 0: 68
1: 24
2: 22
3: 80
4: 819
Right 942953586 2:181749792-181749814 GCCCCTTTGCTGCAGGTCGCTGG No data
942953581_942953586 12 Left 942953581 2:181749757-181749779 CCCTTCTGTTTGTTAGTTTTCCT 0: 5634
1: 2408
2: 568
3: 212
4: 926
Right 942953586 2:181749792-181749814 GCCCCTTTGCTGCAGGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942953586 Original CRISPR GCCCCTTTGCTGCAGGTCGC TGG Intergenic
No off target data available for this crispr