ID: 942955677

View in Genome Browser
Species Human (GRCh38)
Location 2:181770272-181770294
Sequence GTTGATGGCAAGAGGCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942955670_942955677 27 Left 942955670 2:181770222-181770244 CCTTCAGTGTTGTGAGTATCTAT No data
Right 942955677 2:181770272-181770294 GTTGATGGCAAGAGGCCTTTAGG No data
942955669_942955677 30 Left 942955669 2:181770219-181770241 CCTCCTTCAGTGTTGTGAGTATC No data
Right 942955677 2:181770272-181770294 GTTGATGGCAAGAGGCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942955677 Original CRISPR GTTGATGGCAAGAGGCCTTT AGG Intergenic
No off target data available for this crispr