ID: 942957408

View in Genome Browser
Species Human (GRCh38)
Location 2:181789281-181789303
Sequence AGAGCTCTTACAGGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942957408_942957410 -3 Left 942957408 2:181789281-181789303 CCTGGAAAACCTGTAAGAGCTCT No data
Right 942957410 2:181789301-181789323 TCTGCTGCTGCTGAAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942957408 Original CRISPR AGAGCTCTTACAGGTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr