ID: 942964592

View in Genome Browser
Species Human (GRCh38)
Location 2:181876324-181876346
Sequence GAGGATTAGTGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942964592_942964598 4 Left 942964592 2:181876324-181876346 CCTTCCTCCTTCCACTAATCCTC No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942964592 Original CRISPR GAGGATTAGTGGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr