ID: 942964598

View in Genome Browser
Species Human (GRCh38)
Location 2:181876351-181876373
Sequence TAAAATGTGTCTTTATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942964594_942964598 -3 Left 942964594 2:181876331-181876353 CCTTCCACTAATCCTCCTTTTAA No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data
942964595_942964598 -7 Left 942964595 2:181876335-181876357 CCACTAATCCTCCTTTTAAAATG No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data
942964592_942964598 4 Left 942964592 2:181876324-181876346 CCTTCCTCCTTCCACTAATCCTC No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data
942964590_942964598 12 Left 942964590 2:181876316-181876338 CCATGTTCCCTTCCTCCTTCCAC No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data
942964589_942964598 25 Left 942964589 2:181876303-181876325 CCATCTTAATTTTCCATGTTCCC No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data
942964593_942964598 0 Left 942964593 2:181876328-181876350 CCTCCTTCCACTAATCCTCCTTT No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data
942964591_942964598 5 Left 942964591 2:181876323-181876345 CCCTTCCTCCTTCCACTAATCCT No data
Right 942964598 2:181876351-181876373 TAAAATGTGTCTTTATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942964598 Original CRISPR TAAAATGTGTCTTTATCTTC AGG Intergenic
No off target data available for this crispr