ID: 942964877

View in Genome Browser
Species Human (GRCh38)
Location 2:181879953-181879975
Sequence GAGTGGTATTTCTGAATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942964876_942964877 -7 Left 942964876 2:181879937-181879959 CCAGAGTTTCATCTCTGAGTGGT No data
Right 942964877 2:181879953-181879975 GAGTGGTATTTCTGAATGCTTGG No data
942964874_942964877 5 Left 942964874 2:181879925-181879947 CCAAACTTTTATCCAGAGTTTCA No data
Right 942964877 2:181879953-181879975 GAGTGGTATTTCTGAATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942964877 Original CRISPR GAGTGGTATTTCTGAATGCT TGG Intergenic
No off target data available for this crispr