ID: 942971004

View in Genome Browser
Species Human (GRCh38)
Location 2:181957807-181957829
Sequence CTGGTGGCTGAGGGTCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942970997_942971004 6 Left 942970997 2:181957778-181957800 CCCATACTCATCAGCCAATGTTG No data
Right 942971004 2:181957807-181957829 CTGGTGGCTGAGGGTCTTGTTGG No data
942970995_942971004 12 Left 942970995 2:181957772-181957794 CCTTACCCCATACTCATCAGCCA No data
Right 942971004 2:181957807-181957829 CTGGTGGCTGAGGGTCTTGTTGG No data
942970996_942971004 7 Left 942970996 2:181957777-181957799 CCCCATACTCATCAGCCAATGTT No data
Right 942971004 2:181957807-181957829 CTGGTGGCTGAGGGTCTTGTTGG No data
942970998_942971004 5 Left 942970998 2:181957779-181957801 CCATACTCATCAGCCAATGTTGA No data
Right 942971004 2:181957807-181957829 CTGGTGGCTGAGGGTCTTGTTGG No data
942970994_942971004 17 Left 942970994 2:181957767-181957789 CCACGCCTTACCCCATACTCATC No data
Right 942971004 2:181957807-181957829 CTGGTGGCTGAGGGTCTTGTTGG No data
942971001_942971004 -8 Left 942971001 2:181957792-181957814 CCAATGTTGATTCTTCTGGTGGC No data
Right 942971004 2:181957807-181957829 CTGGTGGCTGAGGGTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942971004 Original CRISPR CTGGTGGCTGAGGGTCTTGT TGG Intronic
No off target data available for this crispr