ID: 942975974

View in Genome Browser
Species Human (GRCh38)
Location 2:182018219-182018241
Sequence GTTTCTATGCTGGATGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942975970_942975974 26 Left 942975970 2:182018170-182018192 CCTAAACTAAGACCAAATAAAAA No data
Right 942975974 2:182018219-182018241 GTTTCTATGCTGGATGTGTTAGG No data
942975971_942975974 14 Left 942975971 2:182018182-182018204 CCAAATAAAAACATTGAGAGTAT No data
Right 942975974 2:182018219-182018241 GTTTCTATGCTGGATGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942975974 Original CRISPR GTTTCTATGCTGGATGTGTT AGG Intronic
No off target data available for this crispr