ID: 942980392

View in Genome Browser
Species Human (GRCh38)
Location 2:182073775-182073797
Sequence CTGAAGGCACAGAATGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942980389_942980392 -1 Left 942980389 2:182073753-182073775 CCAGAAAGAGGGTTTGGCAGACC No data
Right 942980392 2:182073775-182073797 CTGAAGGCACAGAATGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942980392 Original CRISPR CTGAAGGCACAGAATGTGAA TGG Intronic
No off target data available for this crispr