ID: 942987905 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:182163965-182163987 |
Sequence | AGTTATCTGCAGATGATGCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
942987905_942987906 | -6 | Left | 942987905 | 2:182163965-182163987 | CCTGGCATCATCTGCAGATAACT | No data | ||
Right | 942987906 | 2:182163982-182164004 | ATAACTACTCTCCTTTTGCGAGG | No data | ||||
942987905_942987908 | 16 | Left | 942987905 | 2:182163965-182163987 | CCTGGCATCATCTGCAGATAACT | No data | ||
Right | 942987908 | 2:182164004-182164026 | GTAGCTCTTGACCTGCTACTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
942987905 | Original CRISPR | AGTTATCTGCAGATGATGCC AGG (reversed) | Intronic | ||
No off target data available for this crispr |