ID: 942987905

View in Genome Browser
Species Human (GRCh38)
Location 2:182163965-182163987
Sequence AGTTATCTGCAGATGATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942987905_942987906 -6 Left 942987905 2:182163965-182163987 CCTGGCATCATCTGCAGATAACT No data
Right 942987906 2:182163982-182164004 ATAACTACTCTCCTTTTGCGAGG No data
942987905_942987908 16 Left 942987905 2:182163965-182163987 CCTGGCATCATCTGCAGATAACT No data
Right 942987908 2:182164004-182164026 GTAGCTCTTGACCTGCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942987905 Original CRISPR AGTTATCTGCAGATGATGCC AGG (reversed) Intronic
No off target data available for this crispr