ID: 942988202

View in Genome Browser
Species Human (GRCh38)
Location 2:182166478-182166500
Sequence TACCAACAGCCTCCCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942988196_942988202 -3 Left 942988196 2:182166458-182166480 CCTTTGGACCCTGAGACTTGTAC No data
Right 942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG No data
942988195_942988202 9 Left 942988195 2:182166446-182166468 CCAGGTTCTCAACCTTTGGACCC No data
Right 942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG No data
942988190_942988202 30 Left 942988190 2:182166425-182166447 CCTTCCCTTGGACATTCAGCTCC No data
Right 942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG No data
942988192_942988202 26 Left 942988192 2:182166429-182166451 CCCTTGGACATTCAGCTCCAGGT No data
Right 942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG No data
942988193_942988202 25 Left 942988193 2:182166430-182166452 CCTTGGACATTCAGCTCCAGGTT No data
Right 942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942988202 Original CRISPR TACCAACAGCCTCCCGGGAA GGG Intronic
No off target data available for this crispr