ID: 942991234

View in Genome Browser
Species Human (GRCh38)
Location 2:182205783-182205805
Sequence CTGAGAAGGATTAGTACTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942991234_942991238 14 Left 942991234 2:182205783-182205805 CCCTAAGTACTAATCCTTCTCAG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 942991238 2:182205820-182205842 CAGTAATTAAGTTTGTAATTTGG 0: 1
1: 0
2: 0
3: 15
4: 266
942991234_942991239 15 Left 942991234 2:182205783-182205805 CCCTAAGTACTAATCCTTCTCAG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 942991239 2:182205821-182205843 AGTAATTAAGTTTGTAATTTGGG 0: 1
1: 0
2: 7
3: 30
4: 420
942991234_942991240 16 Left 942991234 2:182205783-182205805 CCCTAAGTACTAATCCTTCTCAG 0: 1
1: 0
2: 1
3: 15
4: 115
Right 942991240 2:182205822-182205844 GTAATTAAGTTTGTAATTTGGGG 0: 1
1: 0
2: 1
3: 29
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942991234 Original CRISPR CTGAGAAGGATTAGTACTTA GGG (reversed) Intronic
900678430 1:3902717-3902739 CTGAGAAGGGAGAGTATTTAAGG + Intergenic
906841984 1:49148812-49148834 CTGAGAAGGCCCAGAACTTATGG + Intronic
907083983 1:51651696-51651718 ATGAGAAACATTCGTACTTAAGG + Intronic
910377306 1:86586687-86586709 TTGAGAGGGATTAGGAGTTAGGG - Intergenic
910941925 1:92545819-92545841 CTGAGAAGGATTAGTATGAAAGG - Intronic
915397925 1:155600051-155600073 CTGAGAAGGATTAGTATAAGAGG - Intergenic
916956073 1:169837074-169837096 CTGAGCAGGAGTCGTACTTTGGG + Exonic
918381523 1:183960377-183960399 CTAAGAACGATTAGGACTTGAGG + Intronic
919120417 1:193333754-193333776 CTGAAAAGGCTTACTACTGAAGG - Intergenic
919496686 1:198280821-198280843 CTTAGAATGCTTAGTAATTATGG - Intronic
920585765 1:207158352-207158374 CTGTAAAGGATTAATACTTAAGG + Intergenic
920777605 1:208955076-208955098 CTGAGAAGCATAAGTAATAAAGG + Intergenic
921315006 1:213882136-213882158 TTGTGCAGGATTAGTACTGATGG - Intergenic
922918524 1:229279015-229279037 CTGAGAAGGAATAGGCTTTAAGG - Intronic
924590577 1:245400294-245400316 GTGAAAAGGATAAATACTTAGGG - Intronic
1064228152 10:13505551-13505573 TTAAGAAGTTTTAGTACTTATGG - Intronic
1066393956 10:35001109-35001131 CTGAGAAGGAGGAGTGCTAATGG - Intergenic
1070367823 10:75753252-75753274 CTGAGAATAAGTAGTACCTAAGG + Intronic
1070513801 10:77184984-77185006 CTGAGAAGTGGTAGTGCTTAGGG + Intronic
1072994591 10:100231749-100231771 CTGAGAAATATCAGTATTTAAGG - Intergenic
1073740660 10:106402524-106402546 CTAAGAAGAATGAGTACTTAGGG + Intergenic
1077629666 11:3802607-3802629 CTGTGAAGGATTGGTGGTTAGGG + Intronic
1082131864 11:48500069-48500091 CTGAAAAAGATTAGTAATTAGGG - Intergenic
1082245091 11:49912163-49912185 CTGAAAAAGATTAGTAATTAGGG + Intergenic
1082565332 11:54670678-54670700 CTGAAAAAGATTAGTAATTAGGG - Intergenic
1087034878 11:93745201-93745223 CTGAGAAGGATTAGTAAAAGAGG - Intronic
1088423843 11:109678685-109678707 CTTAGAAGAATTAATAATTAGGG + Intergenic
1090822040 11:130351410-130351432 CTGGAAAGGATTAGTAGTAATGG - Intergenic
1096171899 12:49478309-49478331 GTCACAAGAATTAGTACTTAAGG - Intronic
1097399167 12:59108653-59108675 CTGAGGAGGATTAGTAAAAAAGG + Intergenic
1098513119 12:71342221-71342243 CTGAGAAACAGTAGCACTTAGGG - Intronic
1099888595 12:88561985-88562007 CTGAGAATGAAAAGTGCTTAAGG - Intronic
1100346118 12:93733364-93733386 TGGAGAAGGATGTGTACTTAGGG + Intronic
1102763538 12:115410814-115410836 TTTAGAAGGAAAAGTACTTAAGG + Intergenic
1104222000 12:126794104-126794126 TTGAGAGGTATTAGTATTTAAGG + Intergenic
1107053415 13:36077098-36077120 TTGAGAAGCATTAGTGCTTGGGG - Intronic
1107576071 13:41723974-41723996 CTGAGCAGGAATAGTTATTAAGG + Intronic
1110189148 13:72710790-72710812 CTGGGAAAGAGTAGTAGTTAGGG - Intronic
1110651179 13:77943500-77943522 ATCAGAAGCAGTAGTACTTACGG - Intergenic
1113037317 13:106064488-106064510 CTGAGATGGATGAGTGTTTAGGG - Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1124194621 15:27610752-27610774 CTTTCAAGGATTAGTACCTAGGG + Intergenic
1127074080 15:55309322-55309344 CTCAGCAGGTTTAATACTTAGGG - Intronic
1135289387 16:21222300-21222322 CTGAGAAGGATTAGTAAAAGAGG - Intergenic
1139811959 16:69627605-69627627 CTGAGAAAGATTGGTACATAAGG - Intronic
1150462024 17:65361316-65361338 CAGAGAAGGCTTAGCACTTTGGG - Intergenic
1150657843 17:67051907-67051929 CTGGGAAGGATTTTAACTTATGG + Intronic
1159038861 18:63303838-63303860 ATGAGAAGGATGAGTAGGTAAGG + Intronic
1164122857 19:22283967-22283989 CTGAGGAGGATTAGTACAAGAGG + Intergenic
1165506435 19:36233878-36233900 CTGAGGAGGATTAGTAAAAAAGG - Intronic
1166596915 19:44058460-44058482 CTGGGCAGGATTACTACTTCAGG - Intronic
925323375 2:2995369-2995391 CTAAGAAGGATGAGAACTGAGGG + Intergenic
925652681 2:6108235-6108257 GTCAGAAGGATTAGAACTTCAGG - Intergenic
926868031 2:17381087-17381109 AGGAGGAGGATAAGTACTTAGGG - Intergenic
928960107 2:36915700-36915722 CTGAGAAAGATTAGGAAATATGG - Intronic
930971180 2:57397589-57397611 CTGAGCAGAATGAGAACTTATGG - Intergenic
933148255 2:78883325-78883347 CTGTGAAGGATTAGGACTTCTGG - Intergenic
933202988 2:79471968-79471990 CTGAGAAGGATTAAGACTTTGGG - Intronic
939194366 2:138954270-138954292 CTGGGATGGATTAAGACTTAGGG - Intergenic
939588215 2:144031300-144031322 TTGAAAAGGATTAGTACCAAAGG - Intronic
939857976 2:147383265-147383287 CTCAGAAGCATTAGTACTTTTGG + Intergenic
940620617 2:156108630-156108652 CTGAGAAGGATTAGCAAATATGG + Intergenic
942991234 2:182205783-182205805 CTGAGAAGGATTAGTACTTAGGG - Intronic
943010687 2:182444660-182444682 CTGAGAAGGCTTAGAAATAATGG + Intronic
947192937 2:227528300-227528322 CTGAGAAGGATAAGAAATTTTGG + Intronic
947275593 2:228388169-228388191 CGGAGAGAGTTTAGTACTTATGG - Intergenic
1170149733 20:13217030-13217052 GTGAGAATGATTAGTATTTAGGG - Intergenic
1170305750 20:14935966-14935988 CCTAGAACAATTAGTACTTATGG - Intronic
1174529995 20:51203987-51204009 ATGATGAAGATTAGTACTTACGG - Intergenic
1175670135 20:60895226-60895248 CTAAGTAGGATTAGTAATAAAGG + Intergenic
1177184420 21:17777765-17777787 GTGAGAAGGAATAGAACTAAGGG + Intergenic
1179108591 21:38425538-38425560 CTGAGAAGTATTAATATTTAGGG + Intronic
1182710924 22:32322786-32322808 CTGAGAAGGAAGAGGACTTTGGG + Intergenic
1184398467 22:44259655-44259677 CTGAGAAGGAAAAGGACTTTGGG + Intronic
1184965940 22:47972392-47972414 TTGAGAAGGATTATTGCTGAGGG + Intergenic
949155932 3:827281-827303 GTGGGAAGGATTACTTCTTACGG + Intergenic
956353532 3:68365502-68365524 ATGAGAAGGATGAGGAGTTAAGG + Intronic
958937535 3:100273007-100273029 CTGAGGAGGATTAGTACAAGAGG - Intronic
961723898 3:128913294-128913316 CTGAGAAGGATAAAAACTAAGGG - Intronic
967307123 3:188069804-188069826 CTGAGAAGGATTTGTCTTTAGGG + Intergenic
967694849 3:192518290-192518312 TTGAGAAGGATTAGGAATTCTGG + Intronic
967934514 3:194716206-194716228 CTGTGAAGAATTTGTATTTAAGG + Intergenic
971830707 4:31689250-31689272 CAGAGAAGTACTAGTATTTATGG - Intergenic
977115435 4:93018948-93018970 CTGATAAGGACTGGTATTTAAGG - Intronic
979382034 4:120018654-120018676 CTGAGAAAGATTACCAGTTATGG - Intergenic
982028531 4:151276488-151276510 CTAAGAAGGATGCGTTCTTAGGG - Intronic
983077060 4:163338782-163338804 CTGAGAGGGATCTGTACTTTTGG - Intronic
984243493 4:177246732-177246754 CTGAGAAGTATTAGAAGTAATGG + Intronic
986201232 5:5580610-5580632 CTGAGAAGGATTAGTCAAGATGG - Intergenic
991322488 5:65389997-65390019 CTTAGAAGTATAAGTAATTAGGG + Intronic
991379756 5:66007623-66007645 CTGAGAAGGAACACTACTAATGG + Intronic
991726321 5:69539440-69539462 ATAAGAAAGATTAATACTTAAGG - Intronic
991868636 5:71088434-71088456 ATAAGAAAGATTAATACTTAAGG + Intergenic
992129581 5:73678248-73678270 TTTAGAAGGATTAGGACTGAGGG + Intronic
995736354 5:115304179-115304201 CTGAAAATGAGTAGTACTCAAGG + Intergenic
998127835 5:139636162-139636184 CTGACAAGGGATAGTCCTTAAGG + Intergenic
1000161101 5:158598480-158598502 ATGAGAAGTATTAGTGCTTTAGG - Intergenic
1000686560 5:164256716-164256738 GTGAGAAGAAATAGTATTTAAGG - Intergenic
1006178404 6:32138087-32138109 CTGAGAAGGAGCAGTAAATAAGG + Intergenic
1011186819 6:84686510-84686532 CTGACATGTATTAGTACATATGG - Intergenic
1011192991 6:84752868-84752890 CTCAGAAGGATTTGTACCCACGG - Intronic
1014701482 6:124694254-124694276 GTGAGTAGGAATAGTACTTGAGG + Intronic
1019949326 7:4358562-4358584 CAGAGAAGTATTATTAGTTAGGG - Intergenic
1020894408 7:13921638-13921660 CTGGGAAGGATTATTTATTATGG + Intronic
1022163196 7:27732400-27732422 CTGAGGAAGATTAGTACTTATGG + Intergenic
1027812965 7:82929034-82929056 CTGAGAAAGAGTAGTTTTTAGGG + Intronic
1030652193 7:112128231-112128253 CTGAGAGGGATCAGTTTTTAAGG - Intronic
1034794353 7:153999576-153999598 CTATGAAGGATAAGTCCTTAAGG + Intronic
1036286921 8:7450991-7451013 CTGACAAGGCTAAGTACTTTTGG + Intronic
1037390038 8:18383767-18383789 CTGAGAAGCATTTGTCCTTCTGG + Intergenic
1040389616 8:46938503-46938525 CTGAGAAGGATTGGTGCTATCGG + Intergenic
1041327785 8:56687557-56687579 CTGAGAAAGATTATTACTACTGG + Intergenic
1044829052 8:96227697-96227719 TTGTGAAGGATTATTACTTTGGG + Intronic
1045983884 8:108224971-108224993 ACTAGAAAGATTAGTACTTAAGG - Intronic
1047290633 8:123526633-123526655 TTGAGTAGGAGTAGAACTTAGGG - Intronic
1048114153 8:131502058-131502080 CTGAGAAGAATAAGTACATAGGG + Intergenic
1057131778 9:92659031-92659053 ATAAGAAAGATCAGTACTTACGG + Intronic
1059920981 9:119159483-119159505 CTGGGAAGGAGTGGTACTAAGGG - Intronic
1203369577 Un_KI270442v1:290116-290138 CTGAGGAGGATTAGTAAAAAAGG + Intergenic
1187385765 X:18847003-18847025 CTGAGAAGGATTAGTAAAAGAGG - Intergenic
1188102075 X:26101005-26101027 CTGAGAAACATTAATATTTAAGG - Intergenic
1189839733 X:45061790-45061812 CTTATAAGAATTAATACTTAGGG - Intronic
1193143175 X:78050955-78050977 CAGAGAAGGATGTGTACTGATGG + Intergenic
1194062356 X:89219742-89219764 CTGAGTATGTTTAGTAGTTATGG - Intergenic
1195353043 X:104012948-104012970 CTGACAATGTTTAGTACTGAGGG + Intronic
1197627423 X:128817924-128817946 TTGAGAAGCAATAGTACTAAGGG + Intergenic
1198087653 X:133295759-133295781 CTGAGAAGGCTGAACACTTAAGG - Intergenic
1200716224 Y:6548708-6548730 CTGAGTATGTTTAGTAGTTATGG - Intergenic
1201039190 Y:9812409-9812431 TTGAGAATAATTACTACTTATGG + Intergenic
1202069554 Y:20976595-20976617 CTGAGAAGGATTAGTAAAAGAGG - Intergenic
1202183779 Y:22162046-22162068 TTGAGAATAATTATTACTTATGG + Intergenic
1202207580 Y:22424355-22424377 TTGAGAATAATTATTACTTATGG - Intergenic