ID: 942995485

View in Genome Browser
Species Human (GRCh38)
Location 2:182255178-182255200
Sequence CTATAAACACAGGTTGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942995485_942995487 2 Left 942995485 2:182255178-182255200 CCTAGATCAACCTGTGTTTATAG No data
Right 942995487 2:182255203-182255225 ACCACTAGCCATCAATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942995485 Original CRISPR CTATAAACACAGGTTGATCT AGG (reversed) Intronic
No off target data available for this crispr