ID: 942997009

View in Genome Browser
Species Human (GRCh38)
Location 2:182275138-182275160
Sequence GAGGGTCAAAAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942996999_942997009 26 Left 942996999 2:182275089-182275111 CCAGGGAATAGTGAGGATAACCC No data
Right 942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG No data
942997001_942997009 6 Left 942997001 2:182275109-182275131 CCCAAATAAGCAACTGCAGGAAG No data
Right 942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG No data
942997002_942997009 5 Left 942997002 2:182275110-182275132 CCAAATAAGCAACTGCAGGAAGC No data
Right 942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942997009 Original CRISPR GAGGGTCAAAAGAGGGAGGC AGG Intronic
No off target data available for this crispr