ID: 942999754

View in Genome Browser
Species Human (GRCh38)
Location 2:182311511-182311533
Sequence CTGTAGGACCAGAAGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942999754_942999757 7 Left 942999754 2:182311511-182311533 CCTTCCTACTTCTGGTCCTACAG No data
Right 942999757 2:182311541-182311563 TTTCTAAAATGTCATATAAATGG 0: 5
1: 46
2: 304
3: 1060
4: 3090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942999754 Original CRISPR CTGTAGGACCAGAAGTAGGA AGG (reversed) Intronic
No off target data available for this crispr