ID: 943004274

View in Genome Browser
Species Human (GRCh38)
Location 2:182370482-182370504
Sequence GGATGACTGGGAACAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943004271_943004274 -6 Left 943004271 2:182370465-182370487 CCTGAACTTTTATTTAAGGATGA No data
Right 943004274 2:182370482-182370504 GGATGACTGGGAACAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943004274 Original CRISPR GGATGACTGGGAACAATGTC AGG Intronic
No off target data available for this crispr