ID: 943006101

View in Genome Browser
Species Human (GRCh38)
Location 2:182389799-182389821
Sequence CAGTGCAGACAGAATAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943006099_943006101 -7 Left 943006099 2:182389783-182389805 CCATCTTATCAGCTGTCAGTGCA No data
Right 943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG No data
943006097_943006101 12 Left 943006097 2:182389764-182389786 CCCTCAATCTGGGTGAGCACCAT 0: 18
1: 365
2: 964
3: 1151
4: 973
Right 943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG No data
943006098_943006101 11 Left 943006098 2:182389765-182389787 CCTCAATCTGGGTGAGCACCATC 0: 18
1: 368
2: 929
3: 1271
4: 1166
Right 943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943006101 Original CRISPR CAGTGCAGACAGAATAAGGC AGG Intronic
No off target data available for this crispr