ID: 943006893

View in Genome Browser
Species Human (GRCh38)
Location 2:182395812-182395834
Sequence AGTTATCTGGAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943006893_943006899 22 Left 943006893 2:182395812-182395834 CCTGCCATCTTCTCCAGATAACT No data
Right 943006899 2:182395857-182395879 CTTGGCCTGTTATTAGGCTTTGG No data
943006893_943006898 16 Left 943006893 2:182395812-182395834 CCTGCCATCTTCTCCAGATAACT No data
Right 943006898 2:182395851-182395873 ACAGCTCTTGGCCTGTTATTAGG No data
943006893_943006896 4 Left 943006893 2:182395812-182395834 CCTGCCATCTTCTCCAGATAACT No data
Right 943006896 2:182395839-182395861 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943006893 Original CRISPR AGTTATCTGGAGAAGATGGC AGG (reversed) Intronic
No off target data available for this crispr