ID: 943010206

View in Genome Browser
Species Human (GRCh38)
Location 2:182438799-182438821
Sequence GGCAATGGGGAGCCACTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943010198_943010206 22 Left 943010198 2:182438754-182438776 CCAAATTATATATGCCATACTGA No data
Right 943010206 2:182438799-182438821 GGCAATGGGGAGCCACTAGTGGG No data
943010199_943010206 8 Left 943010199 2:182438768-182438790 CCATACTGAAGAGCTGAGACTAT No data
Right 943010206 2:182438799-182438821 GGCAATGGGGAGCCACTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943010206 Original CRISPR GGCAATGGGGAGCCACTAGT GGG Intronic
No off target data available for this crispr