ID: 943011956

View in Genome Browser
Species Human (GRCh38)
Location 2:182460937-182460959
Sequence CAAGGAAAACAAAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943011949_943011956 0 Left 943011949 2:182460914-182460936 CCACTCTCCTCCACTTGGTATTA No data
Right 943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG No data
943011952_943011956 -10 Left 943011952 2:182460924-182460946 CCACTTGGTATTACAAGGAAAAC No data
Right 943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG No data
943011945_943011956 29 Left 943011945 2:182460885-182460907 CCAACCTAAGAGTAGCATTCTTA No data
Right 943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG No data
943011948_943011956 1 Left 943011948 2:182460913-182460935 CCCACTCTCCTCCACTTGGTATT No data
Right 943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG No data
943011951_943011956 -7 Left 943011951 2:182460921-182460943 CCTCCACTTGGTATTACAAGGAA No data
Right 943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG No data
943011946_943011956 25 Left 943011946 2:182460889-182460911 CCTAAGAGTAGCATTCTTATTTA No data
Right 943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943011956 Original CRISPR CAAGGAAAACAAAAGGTGGA GGG Intronic
No off target data available for this crispr