ID: 943018238

View in Genome Browser
Species Human (GRCh38)
Location 2:182540697-182540719
Sequence AACTGTGTACATATGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943018238_943018239 -10 Left 943018238 2:182540697-182540719 CCTTTCTTCATATGTACACAGTT No data
Right 943018239 2:182540710-182540732 GTACACAGTTTGTCGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943018238 Original CRISPR AACTGTGTACATATGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr