ID: 943019252

View in Genome Browser
Species Human (GRCh38)
Location 2:182552900-182552922
Sequence CGGCAAACAGCTGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943019252_943019261 23 Left 943019252 2:182552900-182552922 CCATCCACCACAGCTGTTTGCCG No data
Right 943019261 2:182552946-182552968 CCCATCCCTCCAGATCCAGCAGG No data
943019252_943019263 24 Left 943019252 2:182552900-182552922 CCATCCACCACAGCTGTTTGCCG No data
Right 943019263 2:182552947-182552969 CCATCCCTCCAGATCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943019252 Original CRISPR CGGCAAACAGCTGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr