ID: 943023973

View in Genome Browser
Species Human (GRCh38)
Location 2:182606950-182606972
Sequence AGGTGCTGCCGCTGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943023969_943023973 12 Left 943023969 2:182606915-182606937 CCAGTCACTGAGACAATAAGTAT No data
Right 943023973 2:182606950-182606972 AGGTGCTGCCGCTGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943023973 Original CRISPR AGGTGCTGCCGCTGAGGAGA TGG Intergenic
No off target data available for this crispr