ID: 943025450

View in Genome Browser
Species Human (GRCh38)
Location 2:182622663-182622685
Sequence GCTTCCTACTGACCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943025450_943025454 -7 Left 943025450 2:182622663-182622685 CCACTCCCAGGTCAGTAGGAAGC No data
Right 943025454 2:182622679-182622701 AGGAAGCAAAGGTACTGACCTGG No data
943025450_943025456 10 Left 943025450 2:182622663-182622685 CCACTCCCAGGTCAGTAGGAAGC No data
Right 943025456 2:182622696-182622718 ACCTGGGCTGAGATCTCAGAAGG No data
943025450_943025455 -6 Left 943025450 2:182622663-182622685 CCACTCCCAGGTCAGTAGGAAGC No data
Right 943025455 2:182622680-182622702 GGAAGCAAAGGTACTGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943025450 Original CRISPR GCTTCCTACTGACCTGGGAG TGG (reversed) Intergenic
No off target data available for this crispr