ID: 943026779

View in Genome Browser
Species Human (GRCh38)
Location 2:182638869-182638891
Sequence CTGAATAAACAGAAGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943026777_943026779 4 Left 943026777 2:182638842-182638864 CCAGATCAGGAGGGAACCAGATA No data
Right 943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG No data
943026772_943026779 23 Left 943026772 2:182638823-182638845 CCTTTCCACACAAGAGATTCCAG No data
Right 943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG No data
943026773_943026779 18 Left 943026773 2:182638828-182638850 CCACACAAGAGATTCCAGATCAG No data
Right 943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943026779 Original CRISPR CTGAATAAACAGAAGCCATG TGG Intergenic
No off target data available for this crispr