ID: 943027165

View in Genome Browser
Species Human (GRCh38)
Location 2:182643650-182643672
Sequence AAGAGCAATGCTAATAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943027165_943027170 30 Left 943027165 2:182643650-182643672 CCAGAACTATTAGCATTGCTCTT No data
Right 943027170 2:182643703-182643725 AAATGGAGGTCCAGAAACAATGG No data
943027165_943027169 16 Left 943027165 2:182643650-182643672 CCAGAACTATTAGCATTGCTCTT No data
Right 943027169 2:182643689-182643711 AAGAAAAGGTTTAAAAATGGAGG No data
943027165_943027167 2 Left 943027165 2:182643650-182643672 CCAGAACTATTAGCATTGCTCTT No data
Right 943027167 2:182643675-182643697 TCTTCAGGAAGAGAAAGAAAAGG No data
943027165_943027168 13 Left 943027165 2:182643650-182643672 CCAGAACTATTAGCATTGCTCTT No data
Right 943027168 2:182643686-182643708 AGAAAGAAAAGGTTTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943027165 Original CRISPR AAGAGCAATGCTAATAGTTC TGG (reversed) Intergenic
No off target data available for this crispr