ID: 943033875

View in Genome Browser
Species Human (GRCh38)
Location 2:182716471-182716493
Sequence CCATGCCCACCTTGCCATCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 154}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943033875_943033888 12 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033888 2:182716506-182716528 GGCTTTGCTGGAGCCGGTGGTGG 0: 1
1: 0
2: 4
3: 35
4: 275
943033875_943033890 18 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033890 2:182716512-182716534 GCTGGAGCCGGTGGTGGCCTGGG 0: 1
1: 0
2: 2
3: 39
4: 382
943033875_943033892 26 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033892 2:182716520-182716542 CGGTGGTGGCCTGGGCCCTCCGG 0: 1
1: 0
2: 0
3: 22
4: 247
943033875_943033882 -9 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033882 2:182716485-182716507 TGGGCATGGGCCCGGGGCTAGGG 0: 1
1: 1
2: 2
3: 20
4: 311
943033875_943033881 -10 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033881 2:182716484-182716506 GTGGGCATGGGCCCGGGGCTAGG 0: 1
1: 0
2: 3
3: 65
4: 623
943033875_943033883 0 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033883 2:182716494-182716516 GCCCGGGGCTAGGGCTTTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 185
943033875_943033886 6 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033886 2:182716500-182716522 GGCTAGGGCTTTGCTGGAGCCGG 0: 1
1: 0
2: 1
3: 18
4: 304
943033875_943033889 17 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033889 2:182716511-182716533 TGCTGGAGCCGGTGGTGGCCTGG 0: 1
1: 0
2: 2
3: 40
4: 356
943033875_943033887 9 Left 943033875 2:182716471-182716493 CCGCGATGGCAAGGTGGGCATGG 0: 1
1: 0
2: 0
3: 7
4: 154
Right 943033887 2:182716503-182716525 TAGGGCTTTGCTGGAGCCGGTGG 0: 1
1: 0
2: 1
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943033875 Original CRISPR CCATGCCCACCTTGCCATCG CGG (reversed) Exonic
902925749 1:19694675-19694697 CCATCCCCACCGTGCAATCAGGG - Intronic
903427467 1:23264959-23264981 CCATGCCCTCCTTCCCCTCAAGG + Intergenic
903827379 1:26155965-26155987 CCATGCCCACATTGTCACGGAGG - Intergenic
904494801 1:30880548-30880570 CCCTGCACACCCTGCCATTGGGG - Intronic
904935852 1:34129078-34129100 GCATGCCCACCCTCCCATCCTGG + Intronic
906071905 1:43023011-43023033 CCATCCCCACCTTGCTCTCTGGG - Intergenic
906188383 1:43879349-43879371 CCATGCCAACCATGCCATGAAGG - Intronic
907671274 1:56476987-56477009 CCAGGCCCACCAGGCCCTCGAGG - Intergenic
907707154 1:56842442-56842464 CCAGGACCACCTTGACATGGAGG - Intergenic
911407616 1:97462507-97462529 CCAGCCCCACCTTCCCATCATGG - Intronic
914884782 1:151575980-151576002 CCATGCGCACCTACCCACCGAGG - Intronic
1071417576 10:85455379-85455401 CCCTCCCCACCTTCCCATCCGGG - Intergenic
1072726887 10:97819711-97819733 CCCTGACCACCTGGCCTTCGAGG - Intergenic
1072740227 10:97904740-97904762 CGATGTCCACTTTGCCATCACGG + Exonic
1073176379 10:101560002-101560024 GCCTGCCCACCTTGCCCTCTTGG + Intergenic
1074389574 10:113045513-113045535 CCATGCCCACCATGCCCAGGTGG - Intronic
1076451122 10:130557652-130557674 CAATGCCCAACATGCCATCCAGG - Intergenic
1076595526 10:131622768-131622790 ACACACCCACCTTGCCATCAAGG - Intergenic
1076978365 11:192381-192403 CCAAGCCCTCCTTGCTATCCTGG + Intronic
1078360801 11:10666140-10666162 CCATCCCCACCTCTCCATGGTGG - Intronic
1083639174 11:64136105-64136127 CCACTCCCACTCTGCCATCGAGG - Intronic
1084431083 11:69111633-69111655 CCATGCCCATCTTGACCTTGTGG - Intergenic
1087062843 11:93998782-93998804 CAATGCCAACCTTGCCTTCTGGG - Intergenic
1087098027 11:94338641-94338663 CTATGGCAGCCTTGCCATCGGGG + Intergenic
1089272475 11:117311557-117311579 TCATGCCCTCCTTGTCATAGAGG + Intronic
1091854436 12:3728004-3728026 CCATACCCTCCTTGCCCTCAAGG - Intronic
1101645578 12:106628122-106628144 CCATGCCCACAGTGTCATCAAGG + Intronic
1103133234 12:118486494-118486516 CCATGCCCAACTTGCCTTTGGGG - Intergenic
1107803489 13:44132259-44132281 CCCCTCCCACCTTGCCATCAGGG - Intergenic
1108589744 13:51902600-51902622 CCAGCCCCACCTTGCCAGCCAGG + Intergenic
1110928384 13:81184621-81184643 CCATCCCCAACTTCCCATCATGG - Intergenic
1115582875 14:34779008-34779030 CCATGCCCAGCTTGCTTTCTGGG + Intronic
1115650930 14:35402809-35402831 CCATGGCTACCTGGGCATCGTGG - Exonic
1121005365 14:90487289-90487311 CCTTGCCCACCTGGCCAGCTCGG + Intergenic
1121730337 14:96182332-96182354 CCATGCCAGCCTTGCCAGCCTGG + Intergenic
1122143384 14:99675281-99675303 CCAGGCGCACCTCGCCATCCCGG - Exonic
1127390365 15:58500254-58500276 CCATTCCCACCTTACCTACGAGG - Intronic
1128606921 15:69043505-69043527 CCAACCCTACCTTGCCATTGGGG + Intronic
1129352574 15:74965169-74965191 CCTTTCCCACCTTCCCATGGTGG + Intronic
1132531191 16:450709-450731 CCATTCCCACCTTGCTTTCAAGG - Intronic
1132598611 16:764209-764231 CAGTGCCCACCTTGCCACCACGG + Intronic
1134056648 16:11174350-11174372 CTTGGCCCACCTTGCCAGCGCGG - Intronic
1135916679 16:26611139-26611161 CCCAGCCCACCTTTCCATCAGGG + Intergenic
1136497429 16:30652830-30652852 CCATGCTCACCTGGCCTGCGAGG - Exonic
1138124046 16:54424213-54424235 TCATGCCCTCCTGGCCATGGGGG - Intergenic
1138248523 16:55484850-55484872 TCATGCCCACCTTGTCACCAAGG - Intronic
1139196130 16:64920625-64920647 GCATGTCCACCTTCACATCGTGG + Intergenic
1140185148 16:72762957-72762979 CCATGCCCACATTCCCATGTAGG - Intergenic
1140913014 16:79470393-79470415 CCATGCCCTAGTTGCCATCCTGG - Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141623239 16:85248159-85248181 CCAAGCCCACCTGCCCAGCGGGG - Intergenic
1142701062 17:1661162-1661184 CCGTGCCTGCCTTGCCATCTAGG - Exonic
1152015955 17:77750331-77750353 AAGTGCCCCCCTTGCCATCGGGG - Intergenic
1152738887 17:82010628-82010650 CCATGCCCAGCCTGCCACGGGGG + Intronic
1154375964 18:13810114-13810136 CCGGCCCCACCTTCCCATCGTGG + Intergenic
1157595533 18:48861502-48861524 CCAGGGCGAGCTTGCCATCGTGG + Exonic
1160269568 18:77372224-77372246 TCATGCCCACACTGCCATCTCGG + Intergenic
1160720024 19:592950-592972 CCATCCCCACCGTGCAATTGGGG - Intronic
1161337523 19:3722387-3722409 CACTGCCCACCGTGCCACCGCGG - Intronic
1163131563 19:15276651-15276673 CCATACCCACATTGTCATCCTGG + Intronic
1163239590 19:16052290-16052312 CCTTGCCAACCTGGCCTTCGTGG + Intergenic
1164828142 19:31299270-31299292 CCAAGCACACCTTGCCAAGGTGG - Intronic
1165422668 19:35730113-35730135 TCTGGCCCACCTTGCCATCCAGG - Exonic
1166315271 19:41985854-41985876 CCAGGCCCACCTTGCAGCCGTGG + Exonic
1166818483 19:45561501-45561523 TCATGGCCGTCTTGCCATCGTGG - Intronic
927746230 2:25623954-25623976 CCATCCCCAGCTTCCCATCATGG - Intronic
927910464 2:26894450-26894472 TTATGCCCACCTTGCCAAAGAGG - Intronic
929286505 2:40141091-40141113 CCATTCCAACCTTGTCATCAGGG + Intronic
929668929 2:43854034-43854056 ACCTGCCGACCTGGCCATCGGGG + Intronic
929819190 2:45259738-45259760 CCCTGCCCACCTTCCCTTTGGGG - Intergenic
931847971 2:66224193-66224215 CCTTGCCCACCTTTCCACAGGGG + Intergenic
932412972 2:71558223-71558245 CCATGCCCACCTAGCCCCCCTGG - Intronic
933708670 2:85309393-85309415 CCATGCCCACCAGGCCCTCCCGG + Exonic
935632370 2:105222705-105222727 CCATAGCCACCCTGCCATCCTGG + Intergenic
935746125 2:106191912-106191934 TCATGCCCACCTCACCATCTTGG + Intronic
936557946 2:113512143-113512165 ACCTCCCCACCTTGCGATCGGGG + Intergenic
943033875 2:182716471-182716493 CCATGCCCACCTTGCCATCGCGG - Exonic
944049743 2:195454311-195454333 CCAAGCCCTCCTTGCCCTTGAGG + Intergenic
945120925 2:206456211-206456233 GCATGCACACCTTACCATGGTGG + Intronic
948525229 2:238567233-238567255 CCAGGGCCACCTGGCCATGGAGG - Intergenic
949043557 2:241860118-241860140 CCAAGCCCACCTGGCCAGCTGGG - Intergenic
1169080819 20:2796932-2796954 CCCTTCCCACCTTCCCACCGGGG - Intronic
1169415524 20:5412896-5412918 CCATGCCCACCCCCCCAACGAGG - Intergenic
1172100233 20:32480867-32480889 CCAAGCCCACCTAGCCACCAGGG + Intronic
1173913540 20:46689117-46689139 CCCGGCCCACCTTACCAGCGCGG + Exonic
1174546402 20:51328531-51328553 CCATGCCCACCTTCCAAGCATGG + Intergenic
1175072374 20:56345300-56345322 CCAGGGCCACCCTGCCAGCGTGG - Intergenic
1175752469 20:61508839-61508861 CCAAGCCCTCCTTGCCCTCTGGG - Intronic
1178521887 21:33293465-33293487 CTGTGCCCCACTTGCCATCGAGG - Intronic
1179577173 21:42315251-42315273 TCACGCCCACCCTGCCACCGGGG + Intronic
1179879867 21:44288955-44288977 GCAGACCCACCGTGCCATCGGGG + Intronic
1180587093 22:16902328-16902350 CTATGCCCACCGTGCCTTTGAGG + Intergenic
1181107293 22:20582768-20582790 CCCTCCCCACCTGGCCCTCGAGG + Intronic
1181537982 22:23556516-23556538 GCATGCCCACCTTTCCCTCCTGG - Intergenic
1181973400 22:26710973-26710995 CCATTCCCACCTTACCAGAGAGG - Intergenic
1184692040 22:46121840-46121862 CCCTGCCCACCCTGCCCTAGGGG + Intergenic
1184894967 22:47401425-47401447 CCAGGCCCACCATGACCTCGAGG + Intergenic
950065261 3:10107184-10107206 CTCCGCCCACCTTGCCATGGTGG - Intronic
951644152 3:24868571-24868593 CCACACCCACCTTCCCATCATGG - Intergenic
953680866 3:45036954-45036976 CCTGGCCCACCCAGCCATCGTGG + Intergenic
953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG + Intronic
954590059 3:51775671-51775693 CCATCCCCACCCTGCCAGGGTGG - Intergenic
954714727 3:52521351-52521373 CCATCCCCAGCTTGCCCTGGCGG + Exonic
962344828 3:134611252-134611274 CCATGCCCATCTTCCCATCCAGG - Intronic
962972899 3:140421262-140421284 ACAGGCCCACCTTGCCAGCCAGG - Exonic
967166212 3:186782251-186782273 CCTGGCCCACTTTGCCATCTTGG + Intergenic
968923678 4:3535856-3535878 CCCTGCCCACTGTGCCTTCGTGG - Intergenic
973121238 4:46523011-46523033 CTATGCCCACTTTGCCTTTGAGG + Intergenic
985551989 5:538438-538460 GCCTGCCCACCTGGCCATCCAGG - Intergenic
989677340 5:43987013-43987035 CCATGGCCATCTTGCCTTTGAGG + Intergenic
994291607 5:98033746-98033768 CTATGCCCACCTTGCCTTTGAGG + Intergenic
994452214 5:99956400-99956422 CCATGCAGACCTTGCAACCGTGG + Intergenic
998381933 5:141731895-141731917 CCATACCCACCCTGTCATTGGGG + Intergenic
999670114 5:153952323-153952345 CCAAGCCCACCTTACCATTCAGG + Intergenic
999996672 5:157098767-157098789 TCATGCCCACCTTGTCCTTGGGG - Intronic
1001135571 5:169099869-169099891 AGATGCCCTCCTTGCCTTCGGGG - Intronic
1004186792 6:13427969-13427991 CCATCAACACCTTTCCATCGGGG - Intronic
1005884670 6:30087822-30087844 CCATGTCCACTTCCCCATCGGGG + Intergenic
1010324982 6:74554237-74554259 TCATGCCAACTTTGCCACCGTGG + Intergenic
1020305497 7:6830897-6830919 CCATGCCCTCCTTCCTATCAAGG + Intergenic
1020318598 7:6924515-6924537 CCAGGCCACCCCTGCCATCGAGG - Intergenic
1021766736 7:23957273-23957295 CCATGCCCACTGTGCCAGCACGG + Intergenic
1022039325 7:26565294-26565316 TCATGCCCAGGTTGGCATCGGGG - Intergenic
1022227701 7:28380698-28380720 CAGTGCCCACCTGGCCATTGTGG - Intronic
1022327327 7:29344084-29344106 CCATGTCCAGCTTGTCATCAAGG + Intronic
1023817519 7:43961975-43961997 GCATGCCCAGCTTGACCTCGTGG + Intergenic
1025733168 7:64124384-64124406 CCATGCCTATGTTGCCATCGCGG + Intronic
1025739293 7:64183028-64183050 TCCTGCCCGCCTTGCCATCCGGG + Intronic
1029742144 7:102496849-102496871 GCATGCCCAGCTTGACCTCGTGG + Exonic
1029760133 7:102596014-102596036 GCATGCCCAGCTTGACCTCGTGG + Exonic
1033036002 7:137876857-137876879 TCATGCCAACCTTGCCAACACGG - Exonic
1036645502 8:10609486-10609508 CCTGGCCCACCTTGCCAGTGCGG - Exonic
1041390091 8:57340006-57340028 CTTTGCCCACTTTTCCATCGTGG - Intergenic
1045395510 8:101756904-101756926 CCATGACCACCTTTCCAACATGG + Intronic
1045473846 8:102536919-102536941 CCGTGCCCTCCTTCCCTTCGAGG + Intronic
1049258675 8:141627257-141627279 CCATGGACACCCTGCCATCGGGG - Intergenic
1049266365 8:141670011-141670033 GCATCCTCACCTTCCCATCGCGG + Intergenic
1049445679 8:142630243-142630265 CCAGGCCCAACTTCCCATTGTGG + Intergenic
1049482684 8:142834479-142834501 CCAGGCCCACCCTGCCCTCAAGG - Intronic
1050088611 9:1992876-1992898 CCATCCCCACCCTGCCATCCCGG - Intergenic
1050121117 9:2308313-2308335 CCATCCCCACCTTCCCAGCAAGG + Intergenic
1051547431 9:18292298-18292320 CCTTGGCCAGCTTGCCATCTTGG + Intergenic
1053696013 9:40639932-40639954 CTATGCCCACCGTGCCTTTGAGG + Intergenic
1054145827 9:61560119-61560141 CCCTGCCCACTGTGCCTTCGTGG + Intergenic
1054187800 9:61966939-61966961 CCCTGCCCACTGTGCCTTCGTGG - Intergenic
1054307260 9:63439150-63439172 CTATGCCCACCGTGCCTTTGAGG + Intergenic
1054465570 9:65491223-65491245 CCCTGCCCACTGTGCCTTCGTGG + Intergenic
1054650716 9:67621642-67621664 CCCTGCCCACTGTGCCTTCGTGG + Intergenic
1056417154 9:86387939-86387961 CCATGCCCAGCATGGAATCGGGG - Intergenic
1057337360 9:94166369-94166391 CCATACCCACCTCGCGCTCGCGG - Intergenic
1060522813 9:124303369-124303391 ACATGGCAACCTTGCCATTGAGG - Intronic
1061244008 9:129392046-129392068 GCATGCCCACCTTTCCTTCCTGG + Intergenic
1061792163 9:133064542-133064564 CCACTCCCACCTTGCCAGCCAGG - Exonic
1062013118 9:134277504-134277526 CCATGCCCCCCTTGCCCTAGAGG + Intergenic
1062110307 9:134778644-134778666 CCGAGCCCACCTTGCCCTCCCGG + Intronic
1202778460 9_KI270717v1_random:13545-13567 CTATGCCCACCGTGCCTTTGAGG + Intergenic
1185548770 X:967013-967035 GCCTGCCCACCTGGGCATCGGGG + Intergenic
1190115028 X:47620530-47620552 CCAGGCCCCCCTTGCCACCTTGG - Intergenic
1193147593 X:78093225-78093247 GCATGCAAACCTTGCCACCGAGG - Intronic
1197554488 X:127937321-127937343 CTATGCCCACCTTGCCTTGATGG + Intergenic
1200070635 X:153527350-153527372 CCATGCCGTCCCTGCCTTCGGGG + Intronic
1201891619 Y:18948859-18948881 CCAAGCCCCACTTCCCATCGTGG - Intergenic