ID: 943041030

View in Genome Browser
Species Human (GRCh38)
Location 2:182805337-182805359
Sequence GATCCATTGTTGATTGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943041028_943041030 30 Left 943041028 2:182805284-182805306 CCATGTGTCATTTTTTATTGTTG No data
Right 943041030 2:182805337-182805359 GATCCATTGTTGATTGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943041030 Original CRISPR GATCCATTGTTGATTGAATC TGG Intergenic
No off target data available for this crispr