ID: 943041071

View in Genome Browser
Species Human (GRCh38)
Location 2:182805846-182805868
Sequence TTAGGTTATCAGCACTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943041064_943041071 27 Left 943041064 2:182805796-182805818 CCCATTAGCAATCTTGGCGGCCC No data
Right 943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG No data
943041067_943041071 6 Left 943041067 2:182805817-182805839 CCTTCTCTCAAAGCACCCTAGCT No data
Right 943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG No data
943041065_943041071 26 Left 943041065 2:182805797-182805819 CCATTAGCAATCTTGGCGGCCCT No data
Right 943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG No data
943041070_943041071 -10 Left 943041070 2:182805833-182805855 CCTAGCTCAATTTTTAGGTTATC No data
Right 943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG No data
943041066_943041071 7 Left 943041066 2:182805816-182805838 CCCTTCTCTCAAAGCACCCTAGC No data
Right 943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG No data
943041069_943041071 -9 Left 943041069 2:182805832-182805854 CCCTAGCTCAATTTTTAGGTTAT No data
Right 943041071 2:182805846-182805868 TTAGGTTATCAGCACTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943041071 Original CRISPR TTAGGTTATCAGCACTTGAA TGG Intergenic
No off target data available for this crispr