ID: 943042779

View in Genome Browser
Species Human (GRCh38)
Location 2:182823120-182823142
Sequence AAGTTCTATTAGGAATATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943042779_943042781 1 Left 943042779 2:182823120-182823142 CCTAAATATTCCTAATAGAACTT No data
Right 943042781 2:182823144-182823166 TTATGATGATTGCAACCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943042779 Original CRISPR AAGTTCTATTAGGAATATTT AGG (reversed) Intergenic
No off target data available for this crispr