ID: 943045547

View in Genome Browser
Species Human (GRCh38)
Location 2:182857375-182857397
Sequence CTCTGTAAGGCCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943045540_943045547 11 Left 943045540 2:182857341-182857363 CCGGACATGGTGGCTCACGTGTG No data
Right 943045547 2:182857375-182857397 CTCTGTAAGGCCAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943045547 Original CRISPR CTCTGTAAGGCCAAGGTGGG TGG Intronic
No off target data available for this crispr