ID: 943048732

View in Genome Browser
Species Human (GRCh38)
Location 2:182890296-182890318
Sequence CTGGGTTTTCTGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943048732_943048738 18 Left 943048732 2:182890296-182890318 CCTGCATCCCTCAGAAAACCCAG No data
Right 943048738 2:182890337-182890359 CATACTGTATGTTTTTTATAAGG No data
943048732_943048739 25 Left 943048732 2:182890296-182890318 CCTGCATCCCTCAGAAAACCCAG No data
Right 943048739 2:182890344-182890366 TATGTTTTTTATAAGGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943048732 Original CRISPR CTGGGTTTTCTGAGGGATGC AGG (reversed) Intergenic
No off target data available for this crispr