ID: 943050756

View in Genome Browser
Species Human (GRCh38)
Location 2:182910455-182910477
Sequence CAGTTGGAGCCTTGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943050756 Original CRISPR CAGTTGGAGCCTTGGGAACA AGG Intronic
900778898 1:4604499-4604521 CAGATGCAGCCTTGGGAGCTGGG + Intergenic
901536866 1:9888223-9888245 GAGTTTGAGCCTGGGCAACAAGG + Intronic
903151852 1:21415318-21415340 CAGTGGGAACCTTGGGGGCAGGG - Intergenic
904134318 1:28299544-28299566 AAGTTTGAGCCTGGGCAACATGG - Intergenic
904912749 1:33947556-33947578 GGTCTGGAGCCTTGGGAACATGG - Intronic
905012470 1:34756764-34756786 CAGATGGGGGCTTGGGGACAAGG + Intronic
905038583 1:34933137-34933159 CAGGTGGACTCTTTGGAACAAGG + Intergenic
907274573 1:53310142-53310164 CAGTTGGAGTCTTGGTGTCAGGG + Intronic
907471138 1:54674222-54674244 CAGCTGGAGCCTTGGCATTAAGG + Intronic
907910324 1:58820135-58820157 CAGCTGAAGCTTGGGGAACAGGG - Intergenic
908411584 1:63871262-63871284 CAGATGGAGTCTTTGAAACATGG + Intronic
908740713 1:67324554-67324576 GAGTTTGAGCCTGGGTAACATGG - Intronic
910523421 1:88149979-88150001 CAGTTGGAAGGTTGGCAACAAGG - Intergenic
913429759 1:118777561-118777583 CTGTTGGAGGGTTGGGAGCATGG - Intergenic
913606984 1:120475808-120475830 CAGTGGGAACCTTGGGGTCAGGG + Intergenic
913988357 1:143585799-143585821 CAGTGGGAACCTTGGGGGCAGGG - Intergenic
914368726 1:147004157-147004179 CAGTGGGAACCTTGGGGTCAGGG + Intergenic
915346936 1:155202364-155202386 CAGCTGGAGCCCGGGAAACAGGG + Exonic
915642208 1:157237155-157237177 CAGTTAGAACCTTGTGAACAAGG - Intergenic
918345530 1:183604277-183604299 CAGCTGGAGCCCTGGGGAAAAGG + Intergenic
920123545 1:203676190-203676212 CCTTTGGAGGCATGGGAACAAGG - Intronic
921133868 1:212242908-212242930 CAGGTTGAGAGTTGGGAACAGGG + Intergenic
922531281 1:226347222-226347244 CTGTTTGAGCCTTTGGATCAGGG - Intergenic
923844877 1:237719056-237719078 GAGTTTGAGCCTGGGCAACATGG + Intronic
924904927 1:248442043-248442065 CATTTACAGCCTTAGGAACAAGG + Exonic
924922958 1:248649999-248650021 CATTTACAGCCTTAGGAACAAGG - Exonic
1064408992 10:15088912-15088934 CATTTGCAGCCTGGGGAACCCGG - Intergenic
1064909461 10:20384416-20384438 CAGGTGGAGCCATGGGGACAGGG + Intergenic
1065971395 10:30808803-30808825 CACTAGGACCCTTTGGAACAGGG - Intergenic
1067061957 10:43082195-43082217 CAGGAGGAGCTGTGGGAACAAGG - Intronic
1069573276 10:69507205-69507227 CACCTGGGGCCTGGGGAACAAGG + Exonic
1069798278 10:71067017-71067039 CAAAGGGAGCCTTTGGAACAGGG + Intergenic
1071516558 10:86301560-86301582 CAGATGGACCCTTGGCCACAAGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072894950 10:99358796-99358818 CAGGTGTAGCCTGGGCAACATGG + Intronic
1073483561 10:103802433-103802455 CTGATGGAGACTTGGGAACCGGG - Intronic
1074319142 10:112384706-112384728 GAGTTTGAGTCTGGGGAACACGG - Intronic
1075192311 10:120320880-120320902 CACCTGGAGCCATGGAAACAGGG - Intergenic
1075423958 10:122327447-122327469 CAGGTGGTGCCTTGGGGAGAAGG - Intronic
1076373301 10:129968189-129968211 CACTTGGAGCCTTCGGGAAAGGG + Intergenic
1076525930 10:131112391-131112413 CAGTGGGGGCCTGGGGGACAGGG - Intronic
1076697941 10:132256095-132256117 AAGATGGAGCCTGGGGCACAGGG - Intronic
1077906660 11:6539632-6539654 CAGTTGGAGCCTTGCAAAAGTGG + Intronic
1078349821 11:10583378-10583400 CAGGTGGAGTCTTGGGAGCCAGG + Intronic
1078572883 11:12474702-12474724 CACTTGAAGCCTGGGCAACAGGG + Intronic
1080394077 11:31873985-31874007 CAGATGGAGCCTAGGGGATAAGG + Intronic
1084064798 11:66697684-66697706 CCGTTGAAGCCTGGGGAATAAGG - Intronic
1084380253 11:68807408-68807430 CAGTTTGGGCTTTGGGAAGAAGG - Intronic
1084519932 11:69656900-69656922 GAGTTTGAGAGTTGGGAACAAGG - Intronic
1084963708 11:72732483-72732505 GAGGTGGAGCGGTGGGAACAGGG - Intronic
1087709128 11:101529790-101529812 CAGTGGGAGCTTTGGGATCTAGG + Intronic
1089249373 11:117146492-117146514 CAGCTGGAGCCTGAGCAACATGG + Intronic
1091208985 11:133840904-133840926 TAGATGGAGCTTTGGGAACGCGG - Exonic
1096152646 12:49324042-49324064 CTGTTGGAGCCATGGTAACACGG + Intronic
1096677769 12:53234696-53234718 CAGGAGGAGGCTTGGGAAGAGGG + Intergenic
1097049914 12:56216453-56216475 GGGTTGGAGCCTTGTGAACAGGG - Exonic
1097080625 12:56428244-56428266 CTGTCGGAGCCGTGGGAACCTGG - Exonic
1100165493 12:91912884-91912906 GAGCTGGAGCCTTGGTAGCAGGG + Intergenic
1102426168 12:112846034-112846056 CAGCTGGAGCCTAGTGACCAGGG + Intronic
1107256010 13:38427534-38427556 GAGATGGAGTCTTGGGAACATGG - Intergenic
1108662348 13:52598561-52598583 CGGTTGGAGCCTTGGGCATTTGG + Intergenic
1108664835 13:52619196-52619218 GAGTTGGAGCCTGGCCAACATGG - Intergenic
1110471522 13:75865179-75865201 CAGGTGAAGCATTGGGAACCTGG + Intergenic
1110721092 13:78762880-78762902 AAGCTGGAGACTGGGGAACATGG + Intergenic
1111432672 13:88163768-88163790 CTAGTGGAGCCATGGGAACAGGG - Intergenic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1113940984 13:114018555-114018577 CAGTTAGAGCCGTGGGAGCCTGG - Intronic
1115030008 14:28784050-28784072 CAGTTGGAGAATAGGGAAAAGGG + Intronic
1117056834 14:51920843-51920865 CTGTTGGGGCCATGGAAACATGG + Intronic
1117332269 14:54724725-54724747 CATTAGGAGACCTGGGAACAGGG + Intronic
1117997655 14:61493033-61493055 AAGTTGGAGGCATGGGAAGAGGG + Intronic
1118401520 14:65383927-65383949 AAGTTGGAGCCATGGGAAAGGGG + Intergenic
1118767628 14:68920770-68920792 CAGGTGCAGGCATGGGAACAGGG + Intronic
1118975606 14:70673585-70673607 AAGTTGGAGGCTTGGGAATGGGG - Exonic
1121917952 14:97853460-97853482 CAGATGTAGCTTTGGTAACAGGG + Intergenic
1122138581 14:99648702-99648724 CAGTCAGAGCCCTGGGAGCATGG + Intronic
1122286647 14:100656257-100656279 CAGATGGGGCCTTGGGAAAGCGG + Intergenic
1122626054 14:103085852-103085874 CAGCTGGAGCCATGGGCACTGGG + Intergenic
1122753388 14:103956752-103956774 CAGTTGTACTCTTGGGAACTGGG - Intronic
1122773243 14:104106381-104106403 AAGGTGCAGCCGTGGGAACAGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1125873142 15:43120660-43120682 CAGTTGGTTCCTTGGGAAACGGG - Intronic
1125901511 15:43352491-43352513 CAGTAGCAGCCTAGGCAACATGG + Exonic
1125966703 15:43880690-43880712 CACTTGCAGCCTTGGGCACAGGG + Intronic
1127997901 15:64164552-64164574 GAGTTTGAGCCTGGGCAACATGG + Intergenic
1128638052 15:69315785-69315807 CAGTTGGAGCTCTGGGGGCAGGG + Intronic
1128787335 15:70407463-70407485 CACTTGGAGACTTGGCAAGATGG - Intergenic
1131056333 15:89377514-89377536 CAGTTGGCGCCTGCGGAAAATGG + Intergenic
1131390013 15:92040041-92040063 CAGTTGGAGGCTTGGGGGCAAGG + Intronic
1135169082 16:20167109-20167131 GGGTTGGAGCTTTGGGGACAGGG + Intergenic
1137967080 16:52946274-52946296 CTGTTGGGGGCTGGGGAACAAGG - Intergenic
1138530063 16:57629981-57630003 CAGTTGTAGCCTGGGGTCCACGG + Intronic
1139267783 16:65656289-65656311 CAGGAGGAGGCTTGGGATCAGGG - Intergenic
1139660142 16:68415075-68415097 CAGGTGGATCCATGAGAACATGG + Intronic
1140870669 16:79103476-79103498 CAGTGGGGGCCTCAGGAACAGGG - Intronic
1141133998 16:81453899-81453921 CAGGGGAAGACTTGGGAACATGG + Intronic
1141485316 16:84334902-84334924 GAGTTCGAGCCTTGGCAACATGG + Intergenic
1142592426 17:1012197-1012219 CAGGAGAAGCCTTGGGAACTTGG + Intronic
1142613613 17:1122947-1122969 CTGCTGGGGCCTTGGGAACAGGG - Intronic
1143107034 17:4535103-4535125 CAGCTGGAGCTCGGGGAACAGGG + Intronic
1143476736 17:7207484-7207506 GAGCTGGAGACTTGGGGACAGGG + Intronic
1143750575 17:9023751-9023773 CAGCTGCAGCCTTGGGAAAGGGG - Intronic
1143773583 17:9183336-9183358 CAGAAGGAGGCTTGGGCACAGGG + Intronic
1144211778 17:13021941-13021963 AAGTTGGTGTCTTGGGCACAGGG + Intergenic
1144493457 17:15733138-15733160 CAGTTGGAGCCTGGTCATCAGGG + Intronic
1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG + Intronic
1144906805 17:18643514-18643536 CAGTTGGAGCCTGGTCATCAGGG - Intronic
1147155640 17:38543360-38543382 CAGGCGGAGCCCTGGGAAGAGGG + Intronic
1148856222 17:50580525-50580547 CAGATGAAGCCTTGGTAAGAGGG + Intronic
1148879437 17:50714427-50714449 CAGTTGGAGCCTTTCGAGCAGGG + Intergenic
1149644810 17:58232595-58232617 GAGTTGGCTCCTTGGGGACAGGG + Intronic
1150425943 17:65077164-65077186 GAGTTGGAGCTTTGAGAACCTGG + Intergenic
1150650311 17:67005793-67005815 CAGGTGGGGTCTTGGGGACAGGG + Intronic
1150844541 17:68641826-68641848 CAGTTGATGCCTTGGAGACAGGG - Intergenic
1151320301 17:73348798-73348820 CAGTGGGGGCCTGGGGAACACGG + Intronic
1151683840 17:75635565-75635587 CAGTTGGAGCCAGGGCAAAAAGG + Intronic
1157718927 18:49908532-49908554 CAGTTGGAGACTTGGGGCCTGGG - Intronic
1158961865 18:62594463-62594485 CAGCTGTACCATTGGGAACATGG + Intergenic
1160464431 18:79064479-79064501 GAGTTGGAGCCCTGGGAGCAAGG - Intergenic
1161488463 19:4548436-4548458 CAGCTGGTGCCTGGGGGACAGGG + Exonic
1163137017 19:15319262-15319284 GAGTTGCAGCCTGGGAAACATGG + Intronic
1163232798 19:16015633-16015655 CAGTTGGGGCCTGGTCAACAGGG + Intergenic
1165266266 19:34665463-34665485 CACTTTCAGCCTTGGGGACATGG - Intronic
1165956650 19:39505385-39505407 CAGTTGGAGCCTTGGAAACCGGG - Exonic
1166206784 19:41275286-41275308 TAGTTTGAGCCTGGGTAACATGG + Intronic
1166745480 19:45140066-45140088 CAGCTGGAACCTGGGGTACAGGG - Intronic
1167611097 19:50508052-50508074 CATCTGGGGCCTTGGGGACAGGG - Intronic
1167661239 19:50797155-50797177 CAGCTGAGGCCTTGGGCACAGGG - Intergenic
1202708874 1_KI270714v1_random:5552-5574 CAGTGGGAACCTTGGGGTCAGGG + Intergenic
925955825 2:8963035-8963057 GAGTTTGAGCCTGGGCAACATGG + Intronic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
926253468 2:11169617-11169639 GTGCTGGAGCCCTGGGAACACGG - Intronic
928181193 2:29070265-29070287 CTGTTGGAGGGTAGGGAACAAGG - Intronic
929945808 2:46370959-46370981 CCGTGGGCTCCTTGGGAACAAGG + Intronic
930066651 2:47332729-47332751 CAGGTGGGGCCTGGGGAACCAGG + Intergenic
931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG + Intergenic
931469487 2:62524139-62524161 GAGTTTGAGCCTGGGCAACATGG - Intergenic
931471156 2:62538951-62538973 CATTTGGATGCTTGGGAAGATGG + Intergenic
931496546 2:62813440-62813462 CTGGTGGAGCCATGGGAGCAAGG + Intronic
931981823 2:67701505-67701527 CATTTGGAGTTTTGTGAACAAGG - Intergenic
931988341 2:67763039-67763061 CTTTTGGACCCTTGAGAACATGG - Intergenic
932438948 2:71719690-71719712 TAGTGCTAGCCTTGGGAACATGG - Intergenic
932715962 2:74100938-74100960 CAGTTGGAGCTCTGGGCAAAGGG - Exonic
933808952 2:86020344-86020366 GAGTTTGAGCCTGGGCAACATGG + Exonic
935057253 2:99578369-99578391 CCGTTGGAGCCTGGAGACCACGG + Exonic
936063605 2:109313964-109313986 CAGTTGAAGGCTTTGGAACTGGG + Intronic
938162107 2:128995293-128995315 CAGTTGATGCAATGGGAACAAGG - Intergenic
938870134 2:135466875-135466897 CACTTGCAGCCTGGGCAACATGG - Intronic
938998418 2:136705355-136705377 CAATTGGAAGCTTAGGAACAAGG - Intergenic
939864192 2:147454539-147454561 CACTTGGAACCTTGGAAAGATGG - Intergenic
943050756 2:182910455-182910477 CAGTTGGAGCCTTGGGAACAAGG + Intronic
943705637 2:191031022-191031044 CACTTGGAGACATGGGAAGAAGG + Exonic
946241494 2:218358664-218358686 GAGTTTGAGCCTGGGCAACATGG + Intronic
946547163 2:220756825-220756847 CAGTTAGAGCCTTTGTACCAAGG - Intergenic
946639452 2:221767726-221767748 TAGTTGGAGCCAAGAGAACAGGG + Intergenic
948663416 2:239520371-239520393 CAGGTGGGGCCTGGGGAGCAGGG - Intergenic
1168769441 20:405864-405886 CAGTTGGAGGATGGGAAACAGGG + Intergenic
1170993555 20:21328872-21328894 AAGAGGGAGCCTTGGGAATAGGG + Intronic
1172038743 20:32029044-32029066 CAGTGGGAGCCATGGAAAGAAGG - Exonic
1173823801 20:46034830-46034852 CAGTTCGCGCATTGGGAAAATGG - Intronic
1174519249 20:51117024-51117046 AAGGTGGAGCCTGGGCAACATGG + Intergenic
1174537108 20:51259787-51259809 CAGTTAGAGGCTTGGGAAGTGGG - Intergenic
1174697598 20:52576088-52576110 CAGGAGGAGCCTTGAGGACAAGG + Intergenic
1175366448 20:58459607-58459629 CAGATGAGGCCCTGGGAACATGG + Exonic
1175908472 20:62393305-62393327 CAGATGGAGCCTGGGGAACAGGG - Intronic
1176262827 20:64191746-64191768 ATGTTGGAGCCTGGGGCACAAGG + Intronic
1176425154 21:6544134-6544156 TGGTAGGAGCATTGGGAACAAGG + Intergenic
1178247180 21:30964630-30964652 CAGCAGCATCCTTGGGAACAAGG + Intergenic
1178499962 21:33117626-33117648 CAGGTGCTGCCTCGGGAACACGG - Intergenic
1179700645 21:43152451-43152473 TGGTAGGAGCATTGGGAACAAGG + Intergenic
1179833533 21:44012793-44012815 CAGTTGGAGCCGGTGGAACCCGG + Intronic
1181179346 22:21055953-21055975 CAGCTGGTGACTTGGGAAGAAGG - Intronic
1181272969 22:21671168-21671190 CAGCTAGGGCCTTGGGGACATGG + Intronic
1181486477 22:23234805-23234827 GAGCTGGAGCCGTGGGACCAGGG + Intronic
1182376827 22:29854644-29854666 GAGTTGGTGTCTTGGGAACGAGG + Intergenic
1182771878 22:32802037-32802059 CAGCTGGAGCCTGGGGGACTGGG + Exonic
1183494249 22:38133399-38133421 CTGGCAGAGCCTTGGGAACAGGG + Intronic
1183953958 22:41368306-41368328 GAGTTGGAGCCCTGGGGACCTGG - Intronic
1184693827 22:46129152-46129174 CAGATGGAGCCCTGTGGACAGGG + Intergenic
1184981809 22:48100592-48100614 CAGCAGGAGCCCAGGGAACATGG - Intergenic
949804948 3:7944509-7944531 CACTTGTAGTCTTGGGAACTTGG - Intergenic
950318478 3:12026929-12026951 CAGTTAGAGCCTTGGTGACTTGG + Intronic
951056709 3:18155446-18155468 AAGTTCAACCCTTGGGAACAGGG - Intronic
952718887 3:36511865-36511887 CATATGGAGCCTGGGAAACAGGG - Intronic
953761214 3:45688766-45688788 CAGGTGCATCATTGGGAACAGGG + Intergenic
955613639 3:60783179-60783201 CAGTGAGAGCCTGGGCAACATGG - Intronic
956641616 3:71421078-71421100 CAGTAGCATCCTTGGGGACATGG - Intronic
956979073 3:74614949-74614971 CAGTTAGGGCCCTCGGAACACGG + Intergenic
959565151 3:107826079-107826101 CAGTTTGAGGCCTGGGATCACGG + Intergenic
961033780 3:123628457-123628479 CAGTTGTAGCCTTGCCAAGAAGG - Intronic
961371401 3:126434040-126434062 CAGTGGGAGCTCTGAGAACATGG - Intronic
962976238 3:140448564-140448586 CAGGTGGATGCTGGGGAACAGGG - Exonic
963325033 3:143852823-143852845 CAGCTGAAGCCTGGGGAATAAGG + Intergenic
965519491 3:169658760-169658782 CTCTGGGTGCCTTGGGAACAGGG + Intronic
966866233 3:184260439-184260461 TAGCTGGAGCCTTTGGAAGAGGG - Intronic
966875945 3:184321754-184321776 CAGTTGGAGCAATGGGCACAGGG - Exonic
967680966 3:192363388-192363410 CTGTTGGAGCCCTGGGAATTCGG + Intronic
969618007 4:8264991-8265013 CAGTGGGGGTCCTGGGAACAGGG + Intergenic
973572660 4:52256321-52256343 CACTTGGGGCCTTGTGAACTAGG + Intergenic
975954386 4:79820610-79820632 CTGGTGGAGCCATGGGGACAGGG - Intergenic
976616568 4:87083964-87083986 CATTTGAAGCCTGGGCAACATGG - Intronic
979526903 4:121727105-121727127 CAGTTGGAAACTGGGGAACCAGG - Intergenic
981271933 4:142855448-142855470 ATGTAGGAGCCTTGGGAATAGGG - Intergenic
984495645 4:180494011-180494033 CAGGAGGAGCCTGGGCAACATGG + Intergenic
985136574 4:186792007-186792029 CAGTTGGAGAGTGGGGAACTAGG - Intergenic
985665413 5:1179503-1179525 CAGGAGCAGCCCTGGGAACATGG - Intergenic
987421084 5:17720623-17720645 AAGTTGGAGTCTTGGGATAAGGG + Intergenic
989041217 5:37231716-37231738 CAGTTAGAGCTTTGGGAAGAGGG - Intronic
989103958 5:37843507-37843529 CATTTGGTGTCTTGGGAACAAGG + Intergenic
991438682 5:66622929-66622951 AAGCTGCAGCCTTAGGAACAGGG - Intronic
992999561 5:82366965-82366987 GAGTTTGAGCCTGGGCAACATGG + Intronic
994292387 5:98043310-98043332 CACTTGGAGCTTAGTGAACAAGG - Intergenic
994579013 5:101614760-101614782 GATTTGGATCCTGGGGAACATGG + Intergenic
994987206 5:106951823-106951845 CAGTTGGAGTTTAGGGAAGAAGG - Intergenic
997120499 5:131168089-131168111 CCATTGCAGCCTTGGCAACAGGG + Intronic
998285950 5:140861129-140861151 CACTTGGAACCTCAGGAACAAGG + Intronic
999926586 5:156385334-156385356 CAGTGGGAGGCTTTGAAACAGGG + Intronic
1001580885 5:172797437-172797459 GAGTTGGAACCTTGGAAACTGGG - Intergenic
1001827857 5:174760532-174760554 CAGTTGGAGCATTAGGAAAAGGG - Intergenic
1003383304 6:5644752-5644774 CAGGCTGAGCCTTAGGAACATGG - Intronic
1006334432 6:33413212-33413234 GGGCTGGAGCCCTGGGAACATGG - Exonic
1007274792 6:40665427-40665449 CATTTGGAGCCCTGGTCACAAGG - Intergenic
1007832190 6:44647160-44647182 GAGTTTGAGCCTGGGCAACATGG - Intergenic
1009456384 6:63861535-63861557 CATATAGGGCCTTGGGAACATGG - Intronic
1011643730 6:89437992-89438014 CAGTGTGAGCCTGGGCAACAAGG - Intronic
1012354862 6:98301460-98301482 CAGATCTAGCCTGGGGAACACGG + Intergenic
1012701416 6:102461467-102461489 CTGTTGGGGGCTGGGGAACAAGG + Intergenic
1013371335 6:109473374-109473396 CAGGGGGAGCCCTGGGCACAGGG - Intronic
1018380448 6:163253973-163253995 CACTGGAAGCCTTGGGGACAAGG + Intronic
1018414333 6:163588422-163588444 CAGTTGGAGTCTTTGGCACGAGG - Intergenic
1019165258 6:170094238-170094260 CAGGGGGAGGTTTGGGAACAAGG - Intergenic
1021123245 7:16820793-16820815 CAGTGGTAGCCTAGGCAACACGG - Intronic
1022387763 7:29917508-29917530 AAGGTGGACCTTTGGGAACAGGG + Intergenic
1025237105 7:57242012-57242034 GAGTTTGAGCCTGGGCAACATGG - Intergenic
1027128793 7:75576016-75576038 CAGTTGGAGCCTGAGGAAGCCGG - Intronic
1028980870 7:96966973-96966995 CAAGTGTAGCCTAGGGAACATGG - Intergenic
1035080435 7:156211322-156211344 CAGTTGAATTCTTGGTAACATGG + Intergenic
1036927613 8:12922370-12922392 AGGGTGGAGCCATGGGAACATGG + Intergenic
1037813235 8:22098733-22098755 CAGCTGCAGCCTTGGGGAGAGGG - Intronic
1039575446 8:38620136-38620158 AAGTTGGAACCATGGGAACGGGG - Intergenic
1042760890 8:72270350-72270372 AAGTTGCAGCCTTGGGAACTTGG - Intergenic
1049459117 8:142714399-142714421 CAGTTCTAGCCTGGGCAACATGG + Intergenic
1050021840 9:1292578-1292600 AAATTGGAGCCATGGGAACCTGG + Intergenic
1050440226 9:5654202-5654224 CACTTGCAGCCTGGGCAACATGG - Intronic
1061677484 9:132226635-132226657 CAGGTGTGGCCTTTGGAACACGG + Intronic
1061887397 9:133598783-133598805 CAGGTGGAGCACTGGGGACAGGG + Intergenic
1062428896 9:136518232-136518254 CAGTTGGAGCCCTCGTTACAGGG + Exonic
1062647543 9:137556573-137556595 CAGTTGAAGCCCTGGGCCCAGGG - Intronic
1185891879 X:3829084-3829106 CATTTGGAGCCTTGGGGGCTGGG + Intronic
1185896984 X:3867498-3867520 CATTTGGAGCCTTGGGAGCTGGG + Intergenic
1185902102 X:3905924-3905946 CATTTGGAGCCTTGGGAGCTGGG + Intergenic
1187307832 X:18112952-18112974 TAGTTGGAACCTTGGGCACCTGG - Intergenic
1188452168 X:30319115-30319137 CAAATGTAGCCCTGGGAACAAGG + Intergenic
1189670996 X:43408505-43408527 CAGTTGGATGCTTCAGAACAAGG + Intergenic
1190110710 X:47587345-47587367 CAGCTGGGGACTTGGGAAGAAGG + Intronic
1190435891 X:50424810-50424832 CTATTGGAGGCTTGCGAACAAGG - Intronic
1192883036 X:75307995-75308017 CAGTTGGGGCATGGGGAGCAAGG - Intergenic
1199572205 X:149277754-149277776 CACTTGGTGCCTTGGGATCCTGG + Intergenic
1200276497 X:154737787-154737809 GAGTTCGAGCCTGGGCAACATGG + Intronic
1200673887 Y:6127214-6127236 CAGTAGCAGCAGTGGGAACATGG + Intergenic
1201685236 Y:16694013-16694035 CACCTGGAGCTTTGGGAAGAAGG + Intergenic
1202099712 Y:21294590-21294612 CAGGTGGAGCTTTGTGAAGAGGG - Intergenic