ID: 943050835

View in Genome Browser
Species Human (GRCh38)
Location 2:182911083-182911105
Sequence TCTTAGGAAAGAACACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943050835_943050837 1 Left 943050835 2:182911083-182911105 CCATTAGGTGTTCTTTCCTAAGA 0: 1
1: 0
2: 7
3: 30
4: 238
Right 943050837 2:182911107-182911129 TTAAACAGAAACCAGCCCTTTGG 0: 10
1: 9
2: 13
3: 40
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943050835 Original CRISPR TCTTAGGAAAGAACACCTAA TGG (reversed) Intronic
903370601 1:22832751-22832773 TCTTAGGTGGGAGCACCTAACGG - Intronic
903957143 1:27033361-27033383 TCTTAGGAAATAAAGCATAAAGG - Intergenic
904837146 1:33346457-33346479 TCTTCTGAAAGGACACCTACTGG - Intronic
907959648 1:59266851-59266873 CCTTAGAAAAGAAACCCTAATGG + Intergenic
908608344 1:65825816-65825838 TCTCAGGAAAGGAAAACTAAAGG - Intronic
908926192 1:69258071-69258093 TTTTAAGAAGGAACAACTAAAGG - Intergenic
909171969 1:72308002-72308024 TCTAAGGAAATGACAACTAAAGG - Intergenic
909277589 1:73708322-73708344 CCTTAGGGAAGAAAGCCTAATGG - Intergenic
910497892 1:87853259-87853281 TCTTAGGAAAGAAAGCCTAATGG + Intergenic
911576480 1:99584534-99584556 TCCTAGGAAAGAACAAAAAATGG + Intergenic
911708859 1:101045793-101045815 TAATAGGAAATAACACTTAATGG - Intergenic
912407459 1:109452601-109452623 TCAGAGGAAAGCACACCAAATGG + Intergenic
916417819 1:164609388-164609410 TCCTAGGTAAGAACACCTGAGGG + Intronic
917934472 1:179851232-179851254 TCTTAGCAAAGACCACCAAGAGG - Exonic
918373879 1:183889051-183889073 ACTTAGGAAAGAACATTTAAAGG - Intronic
919564094 1:199161973-199161995 TCCTAGGAAAGTACAGCAAAAGG + Intergenic
919939807 1:202278459-202278481 ACTAAGGAAAGAAAACCTACTGG + Intronic
920117616 1:203631505-203631527 TCTTAGCTTAGAACACCTCATGG + Intronic
920627171 1:207613444-207613466 TCAGAGGAAAGCACACCAAATGG + Intronic
920918688 1:210279840-210279862 CCTTAGGGAAGAAAGCCTAATGG + Intergenic
920978601 1:210809800-210809822 TCTTAGGGAAGAAAGACTAAGGG + Intronic
921976940 1:221213217-221213239 TCATAAGAAAGAACAAGTAACGG - Intergenic
922429564 1:225536542-225536564 GCTTAGGAAAGCCCACATAAAGG + Intronic
922919239 1:229287501-229287523 TCTTAGAAAAGAATACCCAGAGG + Intronic
1063032885 10:2253701-2253723 ACTTAGGAATGAACACAAAAGGG - Intergenic
1065181927 10:23134972-23134994 TCTTAGGAAACAGCAACCAATGG + Intergenic
1065613092 10:27491684-27491706 TCAGAGGAAAGCACACCAAATGG + Intergenic
1067022816 10:42816577-42816599 TCTGGGAAAAGAACACCCAAAGG - Exonic
1067670126 10:48312556-48312578 TTTTAGGAAATAACATCTTATGG - Intronic
1067992804 10:51234523-51234545 TGTTTGGTAAGAAAACCTAAAGG - Intronic
1068400585 10:56522202-56522224 TCTTAGGAATAAACATTTAATGG + Intergenic
1070048002 10:72858512-72858534 CCTTAGGAAAGAATGCCTAATGG + Intronic
1070500347 10:77066845-77066867 ACTTAGGAAAGAACAACTAGTGG - Intronic
1070972685 10:80580541-80580563 CCTTAGGGAAGAAAGCCTAATGG + Intronic
1072022206 10:91413290-91413312 TCTTAGGATAAAACACTTCAGGG - Intronic
1073536065 10:104277632-104277654 TCATAGGAAAGAAGACTCAAGGG - Intronic
1073980154 10:109145033-109145055 CCTTAGGGAAGAAAGCCTAATGG - Intergenic
1079157553 11:17962730-17962752 TATGGAGAAAGAACACCTAAGGG + Intronic
1079573319 11:21971564-21971586 TATTAGTAAAGAACACATCATGG - Intergenic
1080703411 11:34665605-34665627 TATAAGGAAAGAGCGCCTAAGGG - Intergenic
1081179020 11:39965150-39965172 TCTTAGGGAAGAAAGCCTAATGG - Intergenic
1085378480 11:76090016-76090038 CCTTGGGAAAGAACACCGAATGG - Intronic
1087260185 11:96002462-96002484 TCTTAGGAAAGAAAAGTTAGTGG + Intronic
1088692239 11:112337971-112337993 TCTTAGGCATCAACACCAAAGGG + Intergenic
1088884673 11:113997484-113997506 TTTTAGGAGTGAACACCTCATGG - Intergenic
1090491373 11:127163994-127164016 GTTTAGGAAATAACACCTGAAGG - Intergenic
1090825118 11:130379736-130379758 CCTTAGGGAAGAAAGCCTAATGG - Intergenic
1092128542 12:6092276-6092298 TCTTAGGAAAGAAAGTCTAATGG - Intronic
1093322481 12:17730399-17730421 TCTTAGAAAAAAAAACATAAGGG + Intergenic
1094351437 12:29530276-29530298 TCTTAGGAAAGAGAGTCTAATGG - Intronic
1096374400 12:51096364-51096386 TTTTAGGAAAGAGCACATATGGG - Intronic
1097544588 12:60982982-60983004 GCTTAGGAAAGAAAGCCTAATGG + Intergenic
1097753868 12:63387577-63387599 CCTTAGGGAAGAAAGCCTAATGG + Intergenic
1097863395 12:64540189-64540211 TCTTAAGAAAGAACTCCAATTGG - Intergenic
1099316552 12:81090240-81090262 TTTTAGGAAAGAACCACTAAAGG - Intronic
1099938205 12:89153310-89153332 TCAGAGGAAAGAGCACCAAATGG + Intergenic
1101462738 12:104913337-104913359 CCTTAGGGAAGAAAGCCTAATGG - Intronic
1102493718 12:113305035-113305057 TCTAAGGATCGAACACCTTAGGG + Intronic
1105533312 13:21240518-21240540 TCTTGGAAAAGTAAACCTAATGG - Intergenic
1108241047 13:48464899-48464921 TATTAGAAAAGAAAATCTAAAGG + Intronic
1109459036 13:62629529-62629551 TCTTAGGAACAAACATTTAATGG + Intergenic
1109574632 13:64238238-64238260 TCTGAGGAAAGAAAACCTATAGG + Intergenic
1109768479 13:66936392-66936414 TCTTTGCAAAGAACAATTAAGGG + Intronic
1110831060 13:80031306-80031328 TCTTGAGAAAGAACAGCAAAAGG + Intergenic
1112766552 13:102751955-102751977 CCTTAGGAAAGAAAGCCTAATGG - Intronic
1112986831 13:105460572-105460594 TCTTAGGAAAGACAACCTGTAGG - Intergenic
1113225203 13:108152133-108152155 CCTTAGGGAAGAAAGCCTAATGG + Intergenic
1113713511 13:112487597-112487619 TCTTAAAAATGGACACCTAATGG - Intronic
1115202491 14:30869793-30869815 TCTTAGGAAGGAAGTCCTAGTGG + Intergenic
1115239669 14:31242112-31242134 CCTTAGGAGAGAAAGCCTAATGG + Intergenic
1116075673 14:40107542-40107564 TGTTAGGAAAGAAATTCTAAGGG + Intergenic
1119168978 14:72518372-72518394 TCTTAAGAAACAACCCCTACAGG + Exonic
1119173645 14:72553555-72553577 TCTTAGGAGAGAAAAACTATGGG - Intronic
1121494672 14:94383939-94383961 TCTTGGGAAAAAAACCCTAAGGG - Intronic
1123423973 15:20153755-20153777 TCTGGGAAAAGAACACCCAAAGG - Intergenic
1123533194 15:21160284-21160306 TCTGGGAAAAGAACACCCAAAGG - Intergenic
1124392577 15:29273033-29273055 TCTTAGGGAAGAAAGCCTAATGG + Intronic
1127207112 15:56733002-56733024 TCGTAGGAAAGGAGACCAAAGGG - Intronic
1128404617 15:67323001-67323023 TCAGAGGAAAGCACACCAAATGG + Intronic
1132423786 15:101696755-101696777 TCTTAGGAAAGAAAGCCTAATGG - Intronic
1133480194 16:6162612-6162634 TCCAAGGAAAGAACAACTCAAGG + Intronic
1133872926 16:9706317-9706339 CCTTAGGAAAGAAAGCCTCATGG - Intergenic
1135762963 16:25152277-25152299 CCTTAGGGAAGAACGCCTACAGG + Intronic
1135918592 16:26627590-26627612 TCTTAGGAAAGAAATCCTAATGG - Intergenic
1136860899 16:33702131-33702153 TCTGGGAAAAGAACACCCAAAGG + Intergenic
1137900525 16:52262955-52262977 TCATAGGAAAGAACACAAATGGG + Intergenic
1137995827 16:53211219-53211241 ACTTGGGAAGGAACAGCTAAAGG + Intronic
1138845189 16:60556435-60556457 TCTGAGCAAATAACACTTAAAGG - Intergenic
1139502151 16:67375851-67375873 TCTAAAGAACGAACCCCTAAAGG - Intronic
1139868135 16:70080141-70080163 CCTTTGGAAATGACACCTAAAGG + Intergenic
1140353342 16:74283435-74283457 CCTTAGGAAAGAAAGCCTAATGG - Intergenic
1141851256 16:86647608-86647630 TTTATGGAAAAAACACCTAAAGG + Intergenic
1203122393 16_KI270728v1_random:1550315-1550337 TCTGGGAAAAGAACACCCAAAGG + Intergenic
1143134127 17:4701382-4701404 TCTGAGGAAAGAACACCCAGAGG + Intronic
1143793249 17:9315251-9315273 TCTTAGGAAAGAAAGCCTTATGG - Intronic
1144260644 17:13516676-13516698 TCTTAAAAAAGAACAGCTTAAGG - Intronic
1145124869 17:20291950-20291972 TCTTGGGAAAGAACACTTCCAGG + Intronic
1146419557 17:32670611-32670633 TCAAAGGAAAGCACACCAAATGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148983240 17:51597819-51597841 CCTTAGGGAAGAAAGCCTAATGG + Intergenic
1150181353 17:63124259-63124281 TCTTAAGAAATACAACCTAAGGG + Intronic
1152824713 17:82457611-82457633 TCTTAGCCAAGAAAACCTAATGG + Intergenic
1153444335 18:5155014-5155036 CCTTAGGGAAGAAAGCCTAACGG + Intronic
1153821686 18:8837518-8837540 TCAAAGGAAAGCACACCAAATGG + Intergenic
1154363774 18:13687995-13688017 TCCTAGGGAAGAAAGCCTAATGG - Intronic
1156145637 18:34174020-34174042 TCTTATGAAACATGACCTAATGG + Intronic
1158018378 18:52810760-52810782 TCAGAGGAAAGCACACCAAATGG + Intronic
1159431858 18:68362665-68362687 TCAGAGGAAAGTACACCAAATGG - Intergenic
1159502283 18:69288911-69288933 CCTTAGGAAAGAAAGTCTAATGG + Intergenic
1159601584 18:70433279-70433301 TCTTAGGGAAGAAAGCTTAATGG + Intergenic
1159943884 18:74429318-74429340 TCTCAGGAAAGAAAGCCTCAGGG - Intergenic
1162243989 19:9383619-9383641 TCTTACGAAAGAACTCATAAAGG - Intergenic
1163070952 19:14840983-14841005 TCTGAGGAATAAACACATAAAGG - Exonic
1163072067 19:14852067-14852089 TCTGAGGAATAAAGACCTAAAGG - Intergenic
1164561456 19:29295122-29295144 CCTTAGGAAAGAAAGCCTAGTGG - Intergenic
1165638513 19:37364158-37364180 TCGGAGGAAAGCACACCAAATGG - Exonic
925324219 2:3004788-3004810 TCATAAAAAAGAACAACTAAAGG - Intergenic
925752703 2:7104156-7104178 TCTTATGACGGAACATCTAAGGG - Intergenic
926440865 2:12887215-12887237 TTTTAGGAAAGAGCACCTATGGG - Intergenic
926758432 2:16254322-16254344 CCTTAGGGAAGAACACCTAATGG - Intergenic
928786583 2:34894081-34894103 TCTTAGTAAAGTATAGCTAATGG - Intergenic
929323145 2:40570779-40570801 TCTTAGGAAAAAATATTTAATGG + Intronic
930110718 2:47676320-47676342 CCTTAGGGAAGAAAGCCTAATGG - Intergenic
930216385 2:48701527-48701549 TCGTTTGAACGAACACCTAAAGG - Intronic
930386500 2:50702071-50702093 TCATAGGAAATAAGACCTACAGG + Intronic
931459765 2:62440537-62440559 CCTTAGGGAAGAAGGCCTAATGG + Intergenic
931944665 2:67292324-67292346 GCATAAGAAAGAACAGCTAACGG + Intergenic
934459273 2:94203287-94203309 TCTGGGAAAAGAACACCCAAAGG + Intergenic
936591543 2:113809169-113809191 CCTTAGGGAAGAAAGCCTAACGG - Intergenic
942284198 2:174397347-174397369 ACTTATAATAGAACACCTAAAGG - Intronic
943050835 2:182911083-182911105 TCTTAGGAAAGAACACCTAATGG - Intronic
943635536 2:190302620-190302642 TCTTAGGGAAGAAAGACTAATGG + Intronic
944548549 2:200823039-200823061 TGATAGGAAAGAACTCGTAATGG + Intronic
944949229 2:204728036-204728058 CCTTAGGGAAGAAAGCCTAAAGG + Intronic
1169410396 20:5364393-5364415 CCTTAGGAAAGAAAGACTAATGG + Intergenic
1169892506 20:10468795-10468817 TCTTAGGAAAGAAAACAAATTGG - Intronic
1170128733 20:12995244-12995266 TCTTAGGAAAGAATTTCTGATGG - Intergenic
1171398375 20:24855403-24855425 TCTTAGGGAAGAAAACCTAATGG + Intergenic
1172774076 20:37397184-37397206 TCTGAGGAAAGAACAGCTGCAGG - Intronic
1176226161 20:64000865-64000887 TCTGACTGAAGAACACCTAATGG - Intronic
1177174818 21:17691902-17691924 TCTTTGCAAAGAAAACCTGAGGG + Intergenic
1177491273 21:21829183-21829205 CCTTAGGGAAGAACGCTTAATGG - Intergenic
1181356935 22:22303202-22303224 TCTGGGAAAAGAACACCCAAAGG - Intergenic
1183795717 22:40115708-40115730 TTCTAGGAGATAACACCTAAAGG + Intronic
949966548 3:9361664-9361686 CCTTAGGAAAGAAAATCTAATGG - Intronic
951085901 3:18512352-18512374 TCATAGCTAAGAACACCCAAGGG + Intergenic
952011662 3:28906728-28906750 TCTTAGGAAAGAAAGGCTAATGG - Intergenic
952136098 3:30422351-30422373 ACTTAAGAAAGACCACCTACAGG + Intergenic
952485749 3:33807928-33807950 TCTGAGGCAACAACGCCTAAAGG - Intronic
956523567 3:70132108-70132130 CCTTAGGGAAGAAAGCCTAACGG - Intergenic
956952235 3:74295956-74295978 TCTCAGGAGAGAAAATCTAAGGG - Intronic
957208255 3:77227548-77227570 TCTAAGGAAAGAACAAGTTAAGG + Intronic
957329922 3:78748840-78748862 TCTTTGGAAAGAACAGTAAAAGG + Intronic
960355287 3:116645014-116645036 TGATAGGAAAGAACTCGTAATGG - Intronic
961131684 3:124474125-124474147 CATTAGGAAAGAAAACTTAATGG - Intronic
961414235 3:126745747-126745769 AGTTAGGAAAGAACAACTAGTGG - Intronic
962410366 3:135136097-135136119 TTTTAGGACAGAACACCACAAGG - Intronic
963443129 3:145366890-145366912 TCTTGGGGAAGAAAACCTAACGG - Intergenic
963762358 3:149296523-149296545 CTTTAGGAAAGAAAACTTAATGG - Intergenic
964014265 3:151927650-151927672 ATTTAGGAAAGAAAACCTGAGGG - Intergenic
965793876 3:172417661-172417683 TCTTAGAAAAAAAAATCTAATGG - Intergenic
967250529 3:187533107-187533129 TCTGAAGAAAGAACAGCTAAAGG - Intergenic
967794260 3:193581673-193581695 TGTTAGGAAGGGACACTTAAGGG + Intronic
972673282 4:41234737-41234759 CCTTAGGAAAGAAAGTCTAATGG + Intergenic
972858988 4:43143772-43143794 ACTTAGGAAAAAAGACCCAAGGG + Intergenic
973733134 4:53842963-53842985 CCTTAGGGAAGAAAGCCTAATGG + Intronic
974123908 4:57672256-57672278 ACTTTGCAAAGATCACCTAATGG + Intergenic
974483798 4:62479973-62479995 TCAGAGGAAAGAAAGCCTAAAGG + Intergenic
975120511 4:70722943-70722965 TCTTTTGAAAGGATACCTAAAGG - Intronic
976123471 4:81807974-81807996 TCTTTGCAAAGAACACCAAGTGG + Intronic
976798798 4:88964435-88964457 TATTAGGAAAGACCTCCTAGAGG + Intronic
976920380 4:90433804-90433826 TCTTAGGACAGCACATATAATGG + Intronic
977571733 4:98635935-98635957 GTTTAGGAAAGAGCACCCAAAGG + Intronic
977767313 4:100814773-100814795 TTTTAGGTAAGTACACCTATTGG - Intronic
978153188 4:105461521-105461543 CCTTAGGGAAGAAAACTTAATGG + Intronic
978279351 4:106991432-106991454 TCTTAGGAAGAATCACCTCATGG - Intronic
978958233 4:114640928-114640950 TCTTAGAAAATATCACCAAAAGG + Intronic
980081583 4:128350366-128350388 TCAGAGGAAAGCACACCAAATGG - Intergenic
982805018 4:159752702-159752724 CCTTAGGAAAGAGAGCCTAATGG + Intergenic
983370576 4:166852444-166852466 TCTTAGTGAAGAAAGCCTAATGG - Intronic
984371411 4:178871283-178871305 TCTTAGGAAAAAAGTCCTGATGG - Intergenic
984915757 4:184722654-184722676 TCTTTTGACAAAACACCTAATGG - Intronic
986730526 5:10631997-10632019 ACTTAGGAAAGAAAGCCTCACGG + Intronic
986807838 5:11325716-11325738 CCTTGGGAAAGAAAGCCTAATGG - Intronic
987778920 5:22406785-22406807 TCTTTGAAAAGTACACTTAAAGG + Intronic
988571154 5:32367996-32368018 TAGTAGGAAAGAAAACATAAGGG - Intronic
989320673 5:40130662-40130684 CCTTCGGACAGAACACCTAGGGG - Intergenic
989972015 5:50536066-50536088 CCCTAGGAAAGAAAGCCTAATGG - Intergenic
990697120 5:58431854-58431876 TATTAGCAAATAACATCTAACGG + Intergenic
992114841 5:73530030-73530052 CCTTAGGAAAGAAAGCCTAATGG - Intergenic
993418457 5:87667384-87667406 TCTTAGGACAGTTCACCAAAAGG - Intergenic
993571869 5:89550740-89550762 AATAAGGAAAGAACACCTGAGGG - Intergenic
994037221 5:95215383-95215405 TCTTATGAAAGAAGACAGAAAGG - Intronic
994204351 5:97017265-97017287 TTTTACAAAAGAACATCTAATGG - Intronic
994286681 5:97977527-97977549 TTTTATGAAAGAACAGATAAGGG - Intergenic
994972066 5:106753264-106753286 TCCTAGGCAAGTAGACCTAATGG + Intergenic
995145201 5:108780880-108780902 GCTGAGGAAAGAATATCTAAGGG - Intronic
995337350 5:111014924-111014946 TTATAGGAAAGAACATCTGATGG - Intergenic
995485176 5:112633173-112633195 TCAGAGGAAAGCACACCAAATGG - Intergenic
995883917 5:116871566-116871588 TCTTTGGAAAGAAAAGTTAAGGG + Intergenic
996796402 5:127353001-127353023 TCTTGGGAAAGGAGGCCTAATGG - Intronic
997662300 5:135598968-135598990 TCTTAGGAAAGAAAGTCTAATGG + Intergenic
997756515 5:136404774-136404796 CCTTAGGAAAGAAAGCTTAATGG - Intergenic
999356545 5:150939497-150939519 TCTTAGGAAAAAAAACCCACAGG + Intergenic
999439234 5:151588735-151588757 TCTTAGGGAGGAACACTTCAAGG + Intergenic
1000204744 5:159048100-159048122 TCTTAGGGAAGAAGACAGAATGG + Intronic
1000949736 5:167466005-167466027 CCTTAAGAAAAAAGACCTAATGG + Intronic
1001059594 5:168477190-168477212 TTTTAGGAAAGAATGCCTACTGG - Intergenic
1001325341 5:170719784-170719806 TCGAAGGAAAGAAGCCCTAATGG - Intronic
1003192909 6:3889859-3889881 CCTTAGGGAAGAAAGCCTAAGGG - Intergenic
1003388941 6:5695711-5695733 TCTTGGAAAAGTAAACCTAATGG + Intronic
1003798045 6:9628461-9628483 CCTTAGGAAAAAAAGCCTAATGG + Intronic
1007780196 6:44248151-44248173 TCTTAGGAACTGACACCTCAGGG + Intronic
1010121256 6:72378528-72378550 TATTAGAAAAGGACACCTCAGGG + Intronic
1011505281 6:88035059-88035081 TATTAGCAAATAACACCCAATGG - Intergenic
1012286602 6:97397544-97397566 TTTTATGAAAGAACACCACATGG - Intergenic
1012710938 6:102603717-102603739 TCTTAGGGAAGAAAGGCTAAAGG - Intergenic
1013784667 6:113766012-113766034 TCTTGGGAAACAAGAGCTAAAGG - Intergenic
1014520449 6:122436039-122436061 TTTTAGGAAAGAACACACATAGG + Intergenic
1016560508 6:145391189-145391211 CCTTAGGAAAGAAAGCTTAATGG - Intergenic
1016704921 6:147095586-147095608 TCCTATGAAAGAACACATATGGG - Intergenic
1017354202 6:153482996-153483018 CCTTAGGGAAGAAAGCCTAAGGG - Intergenic
1018260883 6:161969518-161969540 CCTTAGGAAAGGAAACCTAGAGG + Intronic
1018406350 6:163486888-163486910 TGATAGGAAAGTACACTTAAAGG + Intronic
1019001676 6:168758660-168758682 CCTTAGGGAGGAACACCTAATGG - Intergenic
1020695848 7:11413390-11413412 CCTTACGGAAGAACGCCTAAAGG - Intronic
1020768092 7:12351458-12351480 TTTTTAGAAAGATCACCTAAAGG - Intronic
1024397486 7:48886584-48886606 TATTAGAAAAGAATACTTAAGGG + Intergenic
1026350787 7:69513456-69513478 TCTTAGGAAAGAAAGCCTAATGG + Intergenic
1030959760 7:115902815-115902837 TCATAGGAAACAAAAACTAAAGG - Intergenic
1031949471 7:127877414-127877436 TCTCAGGAAAGAACAACAAACGG - Intronic
1034599834 7:152240104-152240126 GGGTAAGAAAGAACACCTAACGG - Intronic
1038627411 8:29207365-29207387 CCTTAGAAAAGAAGACCCAAGGG - Intronic
1039147280 8:34463094-34463116 TCTTAGGAAAGAATAAAGAAGGG - Intergenic
1039987739 8:42462103-42462125 TCCTAGGAAGTGACACCTAAGGG + Intronic
1040605927 8:48931253-48931275 TCTTTGGAAAGAACAATTAAAGG + Intergenic
1041917868 8:63154098-63154120 TCTTAGGAAAGAAAGCCTAACGG + Intergenic
1042205819 8:66328770-66328792 TTTTAGGGAAGAAAGCCTAAGGG - Intergenic
1042761999 8:72281254-72281276 TCTTTGGCAAGAAAGCCTAAGGG + Intergenic
1043013546 8:74910125-74910147 TCTGGGGAAATAAAACCTAAGGG - Intergenic
1043091618 8:75911987-75912009 CCTTAGGAAAGAAAGCCTAATGG + Intergenic
1043333475 8:79145605-79145627 TATTAGAAAACAAAACCTAAGGG + Intergenic
1044070179 8:87750897-87750919 CCTTAGGGAAGAAGACCTAATGG - Intergenic
1045614136 8:103886796-103886818 TATTACTAAAGAACATCTAATGG - Intronic
1045684394 8:104696840-104696862 TAATAGGAAAGAACACTTCAGGG + Intronic
1045770262 8:105729410-105729432 TCTTAGAAAAAAATACATAAAGG - Intronic
1046077403 8:109329878-109329900 TCTTAGCAAAGAAAACATACTGG + Intronic
1046161459 8:110371921-110371943 AATTATGAAAGAACACTTAAGGG + Intergenic
1048030320 8:130625544-130625566 TCTCAGGAAAATGCACCTAAGGG + Intergenic
1048712466 8:137227417-137227439 TCAGAGGAAAGCACACCAAATGG + Intergenic
1051783590 9:20717740-20717762 TATTTGGAAAGAACTTCTAAGGG + Intronic
1052629650 9:31020840-31020862 TCTTCACAAAGAACACTTAAAGG - Intergenic
1053612060 9:39724170-39724192 CCTTAGGGAAGAAAGCCTAATGG - Intergenic
1053870094 9:42482162-42482184 CCTTAGGGAAGAAAGCCTAATGG - Intergenic
1054086197 9:60746986-60747008 CCTTAGGGAAGAAAGCCTAATGG + Intergenic
1054241458 9:62618223-62618245 CCTTAGGGAAGAAAGCCTAATGG + Intergenic
1054301017 9:63380011-63380033 TCTGGGAAAAGAACACCCAAAGG + Intergenic
1054555586 9:66652746-66652768 CCTTAGGGAAGAAAGCCTAATGG + Intergenic
1058398655 9:104587600-104587622 TGTTAGGAAATTAAACCTAAGGG + Intergenic
1058564230 9:106264172-106264194 TCTAAGGAAAGAACAATTACTGG - Intergenic
1186820690 X:13284983-13285005 TCAAAGGAAAGCACACCAAATGG - Intergenic
1187791551 X:22955801-22955823 ACTTAGGGAAGAAAGCCTAATGG - Intergenic
1190549257 X:51562399-51562421 TCCAAGGAAAGAAAACATAAAGG + Intergenic
1191194605 X:57707766-57707788 TCCTAGGACAGAACACCTGGGGG + Intergenic
1192702369 X:73488648-73488670 GCATTGGAAAGAACAGCTAATGG - Intergenic
1193975772 X:88116696-88116718 TCTTAGGAAAAATCACTTGAAGG - Intergenic
1194041394 X:88945834-88945856 TCTTAGGGAAGAAAGCCTAATGG - Intergenic
1194470632 X:94290936-94290958 TCTAAGGACAAGACACCTAAGGG - Intergenic
1194761103 X:97797159-97797181 CCTTAGGGAAGAAAGCCTAATGG - Intergenic
1195740627 X:108061530-108061552 TCTGAGGTAAGAACACTTATTGG + Exonic
1196534396 X:116825044-116825066 CCTTAGGAAAAAAAGCCTAATGG + Intergenic
1199459395 X:148068253-148068275 TCTCAGGAAACAACAGCAAAAGG - Intergenic
1202281535 Y:23195887-23195909 TCTTGAAAAAGAACACCCAATGG + Intronic
1202284356 Y:23222632-23222654 TCTTGAAAAAGAACACCCAATGG - Intronic
1202433207 Y:24810272-24810294 TCTTGAAAAAGAACACCCAATGG + Intronic
1202436030 Y:24837018-24837040 TCTTGAAAAAGAACACCCAATGG - Intronic