ID: 943053813

View in Genome Browser
Species Human (GRCh38)
Location 2:182949863-182949885
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943053810_943053813 3 Left 943053810 2:182949837-182949859 CCAACAAATATTTACTAAGTGCC No data
Right 943053813 2:182949863-182949885 TATGTGTTAGGTCTGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr