ID: 943056904

View in Genome Browser
Species Human (GRCh38)
Location 2:182993315-182993337
Sequence TTGGCTGTTGACTGAATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943056900_943056904 6 Left 943056900 2:182993286-182993308 CCTTTGTGAAATTTTTTCCCGTA No data
Right 943056904 2:182993315-182993337 TTGGCTGTTGACTGAATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943056904 Original CRISPR TTGGCTGTTGACTGAATCTC TGG Intronic
No off target data available for this crispr