ID: 943057297

View in Genome Browser
Species Human (GRCh38)
Location 2:182998206-182998228
Sequence CCATAGCCAATATACGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943057292_943057297 -8 Left 943057292 2:182998191-182998213 CCATCTATGACAAACCCATAGCC 0: 106
1: 1243
2: 2189
3: 2301
4: 2269
Right 943057297 2:182998206-182998228 CCATAGCCAATATACGGAATGGG No data
943057291_943057297 9 Left 943057291 2:182998174-182998196 CCTCAAAATAAGCAGTGCCATCT No data
Right 943057297 2:182998206-182998228 CCATAGCCAATATACGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943057297 Original CRISPR CCATAGCCAATATACGGAAT GGG Intronic
No off target data available for this crispr