ID: 943057297 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:182998206-182998228 |
| Sequence | CCATAGCCAATATACGGAAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943057292_943057297 | -8 | Left | 943057292 | 2:182998191-182998213 | CCATCTATGACAAACCCATAGCC | 0: 106 1: 1243 2: 2189 3: 2301 4: 2269 |
||
| Right | 943057297 | 2:182998206-182998228 | CCATAGCCAATATACGGAATGGG | No data | ||||
| 943057291_943057297 | 9 | Left | 943057291 | 2:182998174-182998196 | CCTCAAAATAAGCAGTGCCATCT | No data | ||
| Right | 943057297 | 2:182998206-182998228 | CCATAGCCAATATACGGAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943057297 | Original CRISPR | CCATAGCCAATATACGGAAT GGG | Intronic | ||
| No off target data available for this crispr | |||||