ID: 943063346

View in Genome Browser
Species Human (GRCh38)
Location 2:183061374-183061396
Sequence GTTGTATTATTAGTAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943063346_943063352 25 Left 943063346 2:183061374-183061396 CCTGTCTTTACTAATAATACAAC No data
Right 943063352 2:183061422-183061444 ACCTGTAGTCCCAGCTACTCAGG 0: 27977
1: 146191
2: 244935
3: 217028
4: 128877
943063346_943063350 -3 Left 943063346 2:183061374-183061396 CCTGTCTTTACTAATAATACAAC No data
Right 943063350 2:183061394-183061416 AACACATTAGCCGGGTGTGGTGG No data
943063346_943063354 28 Left 943063346 2:183061374-183061396 CCTGTCTTTACTAATAATACAAC No data
Right 943063354 2:183061425-183061447 TGTAGTCCCAGCTACTCAGGAGG 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589
943063346_943063349 -6 Left 943063346 2:183061374-183061396 CCTGTCTTTACTAATAATACAAC No data
Right 943063349 2:183061391-183061413 TACAACACATTAGCCGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943063346 Original CRISPR GTTGTATTATTAGTAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr