ID: 943064431

View in Genome Browser
Species Human (GRCh38)
Location 2:183071424-183071446
Sequence CAGCTCAGACAGCTTGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 2, 2: 11, 3: 21, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943064423_943064431 11 Left 943064423 2:183071390-183071412 CCACGTCCTGCTTGGTTTGCTGC 0: 1
1: 0
2: 2
3: 10
4: 222
Right 943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG 0: 1
1: 2
2: 11
3: 21
4: 152
943064426_943064431 5 Left 943064426 2:183071396-183071418 CCTGCTTGGTTTGCTGCAGGGCG 0: 1
1: 0
2: 3
3: 19
4: 118
Right 943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG 0: 1
1: 2
2: 11
3: 21
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943064431 Original CRISPR CAGCTCAGACAGCTTGGCGC TGG Intergenic
900699075 1:4032809-4032831 CAGCACAGTCGGCTTGGCCCGGG - Intergenic
900892290 1:5458271-5458293 CAGCTCTGATAGCTTGAAGCTGG - Intergenic
901863465 1:12089160-12089182 CAGCTCAGAGGTCTTGGCTCTGG + Intronic
902694469 1:18130958-18130980 CAGCTCTGACAGCCTCGGGCCGG + Intronic
903281434 1:22252315-22252337 CAGCTCCGCCAGCCTGGCCCAGG - Intergenic
905813738 1:40931880-40931902 CGGGTCAAACAGCTTGGGGCGGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
907243035 1:53091099-53091121 AAGCCCAGACAGCCTGGCCCAGG - Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
915973573 1:160370740-160370762 CAACTCAGACACCATGGAGCTGG + Exonic
917450993 1:175147107-175147129 CAGCTGTGGCAGCTTGGGGCGGG + Exonic
917978171 1:180253364-180253386 CAGCACAGACCTCTTGGAGCTGG + Intronic
919687056 1:200493567-200493589 CAGCTGTGACAGCTGGGAGCAGG + Intergenic
920160928 1:203997139-203997161 GAGCTCAGACTGCCTGGAGCTGG - Intergenic
923066006 1:230517987-230518009 CAGCTCAGCCAGCTTAGTCCAGG - Intergenic
1063558981 10:7108861-7108883 CAGCTGAGGCAGGTTGGGGCAGG + Intergenic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1067078223 10:43199984-43200006 CAGCACAGCCATCTTGGAGCAGG + Intronic
1067162621 10:43840211-43840233 CAGCTCAATCAGGTTGGGGCTGG - Intergenic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1069554091 10:69385483-69385505 CAGCCCTGACAGCATGGAGCTGG - Intronic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1072954255 10:99874884-99874906 CAGCTCAGGCAGTTGGGGGCAGG - Intergenic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1076679261 10:132163258-132163280 CAGCTCAGCCACCTTAGCCCCGG - Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1079493947 11:21019760-21019782 CAGCTCATCCTGCTTGGCCCTGG - Intronic
1083332706 11:61906361-61906383 CAGGTCACACAGCATGGGGCAGG + Intronic
1084474438 11:69380855-69380877 CAGTTCAGACAGCCTGGGCCAGG - Intergenic
1089225858 11:116921015-116921037 CAGCTCACTCAGCATGGAGCCGG - Intronic
1089535138 11:119156421-119156443 CATCTCAAAGAGCTTGGCACTGG - Exonic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1089696757 11:120220687-120220709 CAGCTGAGACAGCTGAGCACAGG + Intronic
1090131027 11:124142184-124142206 CAGCTCACACAGCTTGCCTGCGG + Intronic
1090383706 11:126344436-126344458 CAGCTCAGACAGCTCCACCCTGG + Intronic
1090823832 11:130369358-130369380 CAGCTCAGACAGCAAGGGACAGG - Intergenic
1093115224 12:15201319-15201341 CAGCTCAGGCAATTTGGCTCTGG - Intronic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1103341918 12:120225274-120225296 CGGCTCAGACAGCCTGGCCCTGG + Intronic
1105783943 13:23729132-23729154 CAGCTCACACAGCCTTGGGCAGG - Intergenic
1106768642 13:32940848-32940870 GAGCACAGACAGCTGGGCCCAGG - Intergenic
1109925047 13:69126408-69126430 CAGCTCAGGCAGCTTCAGGCTGG + Intergenic
1113897723 13:113776468-113776490 CAGCCCAGACAGGCTGGAGCCGG + Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1119325828 14:73759261-73759283 CAGCTGAGGGAACTTGGCGCGGG - Intronic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129330765 15:74826168-74826190 CTGCCCAGAGAGCTTGACGCTGG - Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1133403268 16:5504131-5504153 CAGCACAAGCAGCTTGGCTCAGG + Intergenic
1137036731 16:35574859-35574881 CACTTCAGACAGCTCAGCGCGGG + Intergenic
1137244273 16:46689698-46689720 CAGCTCCGACCCCATGGCGCCGG - Exonic
1139393169 16:66618896-66618918 CAGCTCTGAGCGCTTGGCCCTGG - Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1139631742 16:68235663-68235685 GAGCGCCGACAGCCTGGCGCGGG - Exonic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141461931 16:84182949-84182971 CAGCTCAGACTGCATGGAGCAGG + Intronic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1142202196 16:88766587-88766609 AAGCTCAGTCAGCTGGGCCCAGG - Intronic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1143303755 17:5929902-5929924 CGGGTCAGACAACTAGGCGCTGG - Intronic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1144701673 17:17344636-17344658 CAGCACTGACTGCCTGGCGCTGG + Intronic
1147585961 17:41654223-41654245 CAGCTGAGCCAGCTCAGCGCTGG - Intergenic
1151277117 17:73043518-73043540 CAGCTTAGCCAGCATGGAGCAGG + Intronic
1152592658 17:81221576-81221598 AAACTCAGCCAGCTTGGCCCCGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1158701871 18:59755411-59755433 CACCTCAGACTCCTTGGAGCTGG - Intergenic
1160508925 18:79442539-79442561 AAGCCCAGACACCTTGGAGCCGG + Intronic
1161208047 19:3052252-3052274 CAGGTCACACAGCATGGCCCAGG - Intergenic
1161211406 19:3067962-3067984 AAGGGCAGACAGCTTGCCGCAGG + Intergenic
1162520364 19:11175946-11175968 CATCTCAGCCTGCTTGGCCCTGG - Exonic
1163725826 19:18922523-18922545 CAGCCCAGACAGCGTGGGGAGGG + Intronic
1164435231 19:28222995-28223017 CAGCTCAAACAGCTCTGTGCTGG + Intergenic
1164478765 19:28595335-28595357 CAGATCTTACAGCTTGGGGCTGG + Intergenic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1166693201 19:44836712-44836734 CAGCTCAGAGATCTTGTCCCTGG + Intergenic
929428031 2:41863823-41863845 CAGGTCACACAGCTTGGGTCCGG - Intergenic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
938378626 2:130824340-130824362 GAGCTGGGACAGCTAGGCGCTGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947824007 2:233092120-233092142 CAGCTCTGCGAGGTTGGCGCTGG + Intronic
948041430 2:234904715-234904737 GGGCTCAGACAGCTTGGGTCAGG + Intergenic
948214746 2:236220340-236220362 CAGCTGAGACAGGTGGGAGCAGG - Intronic
1173006491 20:39143263-39143285 AAGCACACACAGCTTGGCACTGG + Intergenic
1176022886 20:62971079-62971101 CAGCACAGACAGCCTCGGGCAGG + Intergenic
1179572252 21:42284652-42284674 CAGCTCGAAGAGTTTGGCGCTGG - Exonic
1179710414 21:43210009-43210031 CAGCCCAGACAGCCGGGTGCTGG - Intergenic
1181021674 22:20106801-20106823 CAGCACACACAGCTGGGCTCAGG - Intronic
1181295192 22:21832459-21832481 CTTCTCAGACAGCCTGGAGCTGG + Intronic
1181671048 22:24425526-24425548 CAGCTCAGCCAGCTCAGCACTGG - Intronic
1184058327 22:42067029-42067051 AAGCTCAGCCAGGTGGGCGCTGG + Intronic
1184839468 22:47044037-47044059 CAGCCCAGGCAGCTGGGCACTGG + Intronic
1185166899 22:49266929-49266951 CAGCTCAGACACCCGGGTGCAGG + Intergenic
949716366 3:6936143-6936165 GAGCTGAGACAGCTGGGTGCTGG - Intronic
950438353 3:12993743-12993765 CAGCTCAGAAAGACTGGCGCTGG + Intronic
950611760 3:14131508-14131530 CAGCCCAGAAAGCCTGGCTCAGG - Intronic
950628376 3:14265091-14265113 CAGCTGTGACAGGTTGGCGGGGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955239267 3:57165058-57165080 AAGAGCAGACAGGTTGGCGCGGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956124050 3:65994690-65994712 TGGCTCAGACAGCTGGGTGCTGG + Intronic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965442230 3:168729290-168729312 CAGATCAGCCAGCTAGGTGCTGG - Intergenic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
967545450 3:190721410-190721432 CAGCTAAGAAAGCTTGGCTAAGG + Intergenic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
972197340 4:36670064-36670086 TAGCTCAGACAGCTGGGAGGTGG + Intergenic
973656133 4:53049719-53049741 CAGATTAGGCAGCTTGGTGCAGG - Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
979439463 4:120734150-120734172 CAGCACAGCCAGCCTGGCACAGG + Intronic
982296464 4:153834195-153834217 CCTCTCAGACACCTTGGGGCTGG + Intergenic
985720433 5:1485994-1486016 CTGCTCTGAGAGCTTGGAGCTGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995805328 5:116045971-116045993 CAGCTGAAACAGCTTGGAGAGGG + Intronic
998530970 5:142884200-142884222 CAGCTGAGACAGATTGTCACAGG - Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999229548 5:150053589-150053611 CAGCTCAGGCCCCTTGGAGCAGG - Exonic
1002705607 5:181159510-181159532 AAGCACAGACAGCATGGGGCAGG + Intergenic
1002875396 6:1205061-1205083 CAGCTCCCACAGCCTGGCGAGGG - Intergenic
1002981127 6:2139937-2139959 CAGCCCAGGCAGCTGAGCGCAGG + Intronic
1004123476 6:12849538-12849560 TAGGTCAGACAGCCTGGGGCTGG + Intronic
1004861021 6:19804844-19804866 CCGCCCAGACTGCCTGGCGCCGG - Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005752599 6:28897111-28897133 GAGCTCAGATTGCTTGGCGAAGG - Intergenic
1010378467 6:75202029-75202051 CAGCTCAGACAGGTTGAGCCTGG - Intronic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1018401245 6:163422749-163422771 CAGCTGAGAAAGGTTGGCCCCGG + Intronic
1020115768 7:5475564-5475586 CAGCTGAGACAGCCTTGGGCTGG - Intronic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024359107 7:48449137-48449159 CAGTACAGACAGCTAGGAGCCGG - Intronic
1026873092 7:73865136-73865158 CAGCCCAGAGAGCCTGGCCCAGG - Exonic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1033248730 7:139740468-139740490 GAGCACAGACAGCTTTGCCCTGG - Intronic
1034063753 7:148117356-148117378 CACCTCTGAGAGTTTGGCGCAGG + Intronic
1038063308 8:23936322-23936344 CAGCTCTGAGAACTTTGCGCGGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1048317652 8:133374285-133374307 CAGCTCTGACTGCTTTGAGCTGG + Intergenic
1048568715 8:135631683-135631705 CAGCTAAAACAGCTTCGGGCAGG + Intronic
1048836655 8:138525096-138525118 AAGATCAGACAGCTTGGAGATGG - Intergenic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058337079 9:103843379-103843401 CAGCCAAGTCAGCTTGGCTCAGG - Intergenic
1058907809 9:109495874-109495896 GCCCTCAGACAGCTTGGAGCAGG - Intronic
1059836568 9:118161194-118161216 AACCTCAGACAGCTTGTCCCTGG - Intergenic
1059948421 9:119437035-119437057 TAGCTCAGCCAGGTTGGCTCTGG + Intergenic
1060879052 9:127104922-127104944 CTGTTCAGAGAGCTTGGGGCAGG - Intronic
1062491664 9:136807939-136807961 CAGCGCCGCCATCTTGGCGCCGG - Exonic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1196156534 X:112436422-112436444 CAGCTCAGAAGGCGAGGCGCTGG - Intergenic
1200408770 Y:2841384-2841406 CAGCTCAGCCAACTTGACGGGGG + Intergenic
1200920983 Y:8612700-8612722 CAGCTCTGACAATTGGGCGCTGG + Intergenic
1200930378 Y:8691584-8691606 CAGCTCTGACAGTTGGGCACTGG - Intergenic