ID: 943066193

View in Genome Browser
Species Human (GRCh38)
Location 2:183089298-183089320
Sequence TGCCTGTCCAGAGGTATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943066193_943066197 13 Left 943066193 2:183089298-183089320 CCCAAAATACCTCTGGACAGGCA No data
Right 943066197 2:183089334-183089356 GCACCTCAACCCAGCCTGGAAGG No data
943066193_943066196 9 Left 943066193 2:183089298-183089320 CCCAAAATACCTCTGGACAGGCA No data
Right 943066196 2:183089330-183089352 AACTGCACCTCAACCCAGCCTGG No data
943066193_943066200 17 Left 943066193 2:183089298-183089320 CCCAAAATACCTCTGGACAGGCA No data
Right 943066200 2:183089338-183089360 CTCAACCCAGCCTGGAAGGGAGG No data
943066193_943066198 14 Left 943066193 2:183089298-183089320 CCCAAAATACCTCTGGACAGGCA No data
Right 943066198 2:183089335-183089357 CACCTCAACCCAGCCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943066193 Original CRISPR TGCCTGTCCAGAGGTATTTT GGG (reversed) Intronic
No off target data available for this crispr