ID: 943066194

View in Genome Browser
Species Human (GRCh38)
Location 2:183089299-183089321
Sequence CTGCCTGTCCAGAGGTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943066194_943066198 13 Left 943066194 2:183089299-183089321 CCAAAATACCTCTGGACAGGCAG No data
Right 943066198 2:183089335-183089357 CACCTCAACCCAGCCTGGAAGGG No data
943066194_943066196 8 Left 943066194 2:183089299-183089321 CCAAAATACCTCTGGACAGGCAG No data
Right 943066196 2:183089330-183089352 AACTGCACCTCAACCCAGCCTGG No data
943066194_943066200 16 Left 943066194 2:183089299-183089321 CCAAAATACCTCTGGACAGGCAG No data
Right 943066200 2:183089338-183089360 CTCAACCCAGCCTGGAAGGGAGG No data
943066194_943066204 30 Left 943066194 2:183089299-183089321 CCAAAATACCTCTGGACAGGCAG No data
Right 943066204 2:183089352-183089374 GAAGGGAGGATTTATCTGCCTGG No data
943066194_943066197 12 Left 943066194 2:183089299-183089321 CCAAAATACCTCTGGACAGGCAG No data
Right 943066197 2:183089334-183089356 GCACCTCAACCCAGCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943066194 Original CRISPR CTGCCTGTCCAGAGGTATTT TGG (reversed) Intronic
No off target data available for this crispr